Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T03E6.4   

sjj_T03E6.4RNAiJA:T03E6.4
PCR_productsjj_T03E6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST03E6.4 Source_evidenceePCR832WS150 Sequence/Annotation Release
Overlaps_Gene T03E6.4 Source_evidenceePCR832WS150 Sequence/Annotation Release
Chunk_score Abs_score685
Max_abs_score685T03E6.4
Specificity_index0.72
Rel_score1
Map_statusUnique_ePCRV1658586216587545
T03E6.1 Chunk_score Abs_score266
Specificity_index0.28
Rel_score0.388
Overlaps_transcriptT03E6.4 Source_evidenceePCR832WS150 Sequence/Annotation Release
WB_DNA_textsjj_T03E6.41684tctttggctccacgtaatccaacatgctggcttctttttcgctcagatcactaatggaatattggtgtatttgatcgcaacaaaagctcaaaaactatttggaacatatcgtcatctaatgtgtgcttttgctgtcttctccctaatttatgcatgggtcgaagtgttcactcaaccggtaggctaaaagctttaagccaagtttgggcctcgaatatgctcgatgaaaaagcaagattaacatttctttaaggtaatgcacataaaaggtccagtgttcatagtcttcatggacagtcctttaaaatatcaagcaggaattggtaattttgtgacgtgtaagtttgtttgaatttattttataatttatttggaatattctaaaaataataaagaaaaatacatttttactgtttgattttgcaatattttattgctttttattatttaccagccgtggaccgcacctacagcgcgacctccgacttttttgagaaaacacattagataaacggtttatatataataaattgattgtttgaattaaaaaaaaaagacaactcccaaccaatcaacgtatagttacgcttccttttaaactaattatgttaaatggttgttgtgtagcgtcgctgattggtgagatactgagcatttctgaaagctgattggtaagataaaactggtggtgaaacgctgattggtgagcgactgggcgtggctgaatgctcattggtaagcaagtgggtgtgactaaacgctgattggtgtgcaagtgggtgtggctaaacgttgattggcttgatagtggtggaagctgaatgctgaagactggccctatcaagaattttgaagatgactatacttttcactaaaattcactaaaattgaaaacctttaaatttgcaatttcaggcctctattgcggatcgtttgctctcgtgatctcacttcttgcgtctcaattttcctacagatttattgccgtttgcaggttgttttttttttcaattttccggaaaaaataatccaaatccttttcagaccagagcttctgccaaaactcgatgggctcaagctagttataatattcattccatgcgtgtttttcttcattctttggtttgaactggtttattggggtatggaaaataccaaggagaaacaggaatatatgaggtagttagcaactaaatttcaaaccttcatgttatacaaaaaaaattcagagaagaactggaaacattctaccaagaagattcgagaaaagtttgttttattgcgccaatgtattggtcaattggaaaaaatggagagaaaatttggaatttttttgagattgggctagcatttggatgtgtgatgataattgtaaggcctacaaaaaaaagccctggagatctagaaaatgtttgtatttttacaggttgtctgcttcacgacgattctattctgctcaataaacatttattatttcatgacaagcatccagtgtcatatgagcaaaagaacattggaactcaatcaccaacttttcgtcaccctcagctttcaggtatatttttgggagtctccttgaaattccatatttagtttccagactcttttaccatttgtcatgatgtacagtcctgtcggattgttgttttgtcttccactatttgaagtctacgggggcgatatt