Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_T03E6.7_b   

sjj_T03E6.7_bSequenceTCTCCATCTCTCTCCTCACACTC
PCR_productsjj_T03E6.7