Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T03F1.11   

sjj_T03F1.11RNAiJA:T03F1.11
PCR_productsjj_T03F1.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T03F1.11 Source_evidenceePCR239WS150 Sequence/Annotation Release
T03F1.7 Source_evidenceePCR166WS150 Sequence/Annotation Release
Overlaps_Gene T03F1.11 Source_evidenceePCR322WS150 Sequence/Annotation Release
Chunk_score Abs_score295
Max_abs_score295T03F1.11
Specificity_index0.611
Rel_score1
Map_statusBest_ePCRI38538623854785
T03F1.7 Source_evidenceePCR229WS150 Sequence/Annotation Release
Chunk_score Abs_score188
Specificity_index0.389
Rel_score0.637
Map_statusTop50_percentile_ePCRI38538623854785
Overlaps_transcript T03F1.11 Source_evidenceePCR322WS150 Sequence/Annotation Release
T03F1.7 Source_evidenceePCR229WS150 Sequence/Annotation Release
WB_DNA_textsjj_T03F1.11924cttggggtgagctttatctttttttttgttgccaaattctataaattttctaattatttccagaacatgaactccgtgagatgttttctctccacgacaaggatatgtctggattcatcagcaaagatgatgtgatctgcatgttgttgggagctgagaaggacgataagaaggatcccgtgttcaagacgaacctcaaatttttgattcaagtcatcaaggaggccgacaaagacggagactccaaaatcactttcgatgagttcaaggagtacatcaacaaagtcacttcctaaaattctttcaatttcttaatgttttatctttccaaaatttataacaaatctaaacaatctcaacaataaacaatctataatataacaaaattatgaacaattaaaattcttgagcgaccacgtgttgtccgccgagtcaattgtcggagccggtgcaaagatgggtacaggaggtggaagagcattgggttcttttgataaatcttccagattatgcagcttgttcgtgtagtcatagaggaataagcccggatatctgaaatgaaaaattattgaatttcaactaaaaagaatcagaatcttcaattcaatttttaattagttggtattgtgaaatatactatttttaaagatattaaaggcatttttatttcaagaaatttctaatttgcagttcttgaaaatgtatcgttaaatatcttcgaaatcattctcgatgtttaaaacttttattagatgcaaatcgtgtgcgcctttaaagagtactgtagtttcaaacttttgttgctccgttttattttgcattaaacaaaaatatgtcgtgtcaagacctgataccgtactttttcggcgaaaaataccaaaatgtgacgtttgtgtagtattgaaagaaggtctgtgttttggt