Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T03F1.3   

sjj_T03F1.3RNAiJA:T03F1.3
PCR_productsjj_T03F1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST03F1.3 Source_evidenceePCR960WS150 Sequence/Annotation Release
Overlaps_Gene T03F1.3 Source_evidenceePCR960WS150 Sequence/Annotation Release
Chunk_score Abs_score879
Max_abs_score879T03F1.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI38676803868791
Overlaps_transcriptT03F1.3 Source_evidenceePCR960WS150 Sequence/Annotation Release
WB_DNA_textsjj_T03F1.31112gctgttccaaccattcaggtaatcaattcaaatttatttcaaacaacattttcaataatattcaaaatttcagcatgctcttagcaacggagccaaatctgtcgttttaatgtcacatttgggacgtccagatggcagacgccaagacaagtacaccttgaaaccagttgctgaagagttgaaggctctcttgaaaaagtttgttgtataatctgattttaaaaaaattacaaatgattttcagagatgttctcttcctcgacgactgtgtcggatcagaagtggaggctgcatgcgccgatccagctcctggatcagtcattctccttgaaaatcttcgttatcatctggaagaggagggcaaaggagtcgatgcatccggtgccaaggttaaggctgattcagcagccgtaaagaaattccgcgagtctctcaccaagcttggcgatatttatgtcaatgatgctttcggaaccgctcacagagcccatagctccatggttggagtcgagcactcacaacgtgcaagtggattcttgctcaagaacgagctctcctactttagcaaggtaattttttcctccaatttttcatattgaattttattattaaattttcaggccctcgacaacccagctcgtccattcctggccatccttggaggagctaaggtcgctgacaagattcagttgatcaagaacttgttagacaaggttaatgagatgatcatcggcggaggaatggcctataccttcttgaaagttgcccagggagtcaagatcggaaactctttgtacgacgaagaaggagcgaaaattgtgaacgagcttcttgaggctgccaaggcaaagggagttcaaatccatctcccagtggatttcgtcattgctgacaagttcgccgaggacgcaacctcgaagaccgtcaccgccgaggaaggtgttccagatggccacatgggacttgatgttgggccggaatcttctaagatcttcgccgctgccattcaacgcgccaaaacgattgtctggaacggtccagcaggagtattcgagtttgataaattcgccacaggcaccaagtcattgatggatgaagttgtcaaggccacc