Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T04A8.11   

sjj_T04A8.11 RNAi JA:T04A8.11
Simmer:T04A8.11
PCR_productsjj_T04A8.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST04A8.11 Source_evidenceePCR550WS150 Sequence/Annotation Release
Overlaps_Gene T04A8.11 Source_evidenceePCR616WS150 Sequence/Annotation Release
Chunk_score Abs_score532
Max_abs_score532T04A8.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII47042774705159
Overlaps_transcriptT04A8.11 Source_evidenceePCR616WS150 Sequence/Annotation Release
WB_DNA_textsjj_T04A8.11883aattatccctgatctcctttccaaattgttatttactttgatcaaattgaacatttttgtgttttacgaatttcttttatttttttcaggtgatgataaatctcagatgtgtatgtcgggctccagtagccaacttgacacagttcactcgtggaatgaagaaatactcatttcctgtaacgtatgaaagtgagttatttcttttctttattttgaagactattagaatttttaacaactgcttcttcattctatcaatttcagatgtccgatttccaccaaatggacagttgaagctaccagtgatgccagctgagccattttatgatgccgaaaaaggagagaaaaagtaagagttttatctctaacctattgataaaagtaatttaattcagatacaagtcaacaaagcgaatgattgaggcgagaggagtagaagaagtacatacagaacttattcacgagcagtatggccttgctgctgtatcaggaggattcattgatagtgatgacttcaaattcattcaagatcgaatcaataaaaatcttattgacaatcagttttctgtctggcgagttgatgcaccatggctgccgagaacaaaaaaagcacagggaactaggttaggaggtggaaaaggatccattcagaagtatgtgacaccagtaagagcaaatcgtattattctggaagttggcgggcatatcactgaaattgaggtattgtttatcatctcaaaatctcccgaattcaattccatgcttaacatcttataggcgaaagcatttctcctgtacctttgcgaacgtttctcattcccagtcgagttcgtaagtgagacaatgcttgcagaaagacgtaaaaaggctgaagaagaacgtg