Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T04A8.14   

sjj_T04A8.14RNAiJA:T04A8.14
PCR_productsjj_T04A8.14
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST04A8.14 Source_evidenceePCR1091WS150 Sequence/Annotation Release
Overlaps_Gene T04A8.14 Source_evidenceePCR1091WS150 Sequence/Annotation Release
Chunk_score Abs_score1028
Max_abs_score1028T04A8.14
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII47184644719651
Overlaps_transcriptT04A8.14 Source_evidenceePCR1091WS150 Sequence/Annotation Release
WB_DNA_textsjj_T04A8.141188catcctctttggctttgtgatagaagaggaactcttcagcggtgagacttcgaactggtttactctaaaaatatatatttattaaaatcctagacatttatttcaaataattctcaccttgatataccgtttgtcatagaggggatgagtttgatcaattgtatcacgtcctttcttcgttggcttgatccaaaaatgtgcagactggcggaattcttgccgaacactatgcctgacttgtggttgtcgactgatctccttggcaagcatgaatttcgcaccattcagaaccatatcactgtcactgaacgcaggacaaacatactcttctgctgcttccaatggtaacatcggatcttgctcaatgtcgtgttttttccagttcaaattttcagaaaactgttttgcagtcaatccaaaccgtccagcaagctctccgattccgttttccacacacatttgatacttatcattacgaatgcttgacttgaacttgactcgatactcttgttcctcttcttcaccggttaaacgtcctttttcccatctaatcatatcgtcgagaagagcaccgtacaacaattggaaatttgcatgtatgtcggtaagctgttcaagagtttctgcgtattttgtgctgaaaaataatttaaattctaaattttaaattttaaaacttactccatcaaatctgcatccgaaatcggtcgtctttttgcggtcaaatcgtcactgagttcctgatactctctcatccgacgcattaaatcgtaaattttatttttcttctctgacaaatgacaccatttttcgtcaaaatcgtatactctccatagattattcattgtcagaagattgtcaatatcttctttacgataaaatccaataaacgtaggttcgaacgaattagaacgaactcgaatgaattggagaactttcttgatggattttataacagctttctttctatcttcatagacagaaggatccagattcattatacaatcaagtttatcgtcttgatccaggtcagcttgatttgtcactgtcccttcttcgaaggcatatttaataatccatagagcttcagattccagttcatcatcatccgcttctgtaactggtgttcttctgagttggaacctctctggtaaatcttctttcgcgattttcttatccccaggtaac