Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T04A8.7   

sjj_T04A8.7 RNAi JA:T04A8.7
Simmer:T04A8.7
PF:GL1_1G5
PCR_productsjj_T04A8.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T04A8.7a Source_evidenceePCR1018WS150 Sequence/Annotation Release
T04A8.7b Source_evidenceePCR1018WS150 Sequence/Annotation Release
Overlaps_Gene T04A8.7 Source_evidenceePCR1018WS150 Sequence/Annotation Release
Chunk_score Abs_score955
Max_abs_score955T04A8.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII46958464696965
Overlaps_transcript T04A8.7b Source_evidenceePCR1018WS150 Sequence/Annotation Release
T04A8.7a Source_evidenceePCR1018WS150 Sequence/Annotation Release
WB_DNA_textsjj_T04A8.71120gcatggagcaactcacttcaaattgagcccatgggcaacttttgtgacatgcccaaatccaaaagaaacggtcatctaccatcaaaacttttggaatccacctgagaagtatcaactgaaagaagctcgcccagctcgtccggcgtcccttagaatctacgaggctcacgttggaatcagtagctcagagggaaaaattaacacatatcgtgaattcgctgacgatgtcttgccgagaatacaaaagcaaggatacaatgcaattcagttgatggcagtgatggagcacgtttattatgcatcatttggatatcaggtttcgaactttttcgctgtttccagtcgctgtggaacaccagaagatttgaaatatttggttgataaggctcattcgttaggaatcttcatgcttcttgatgttgttcattcccatgcttccaaaaatgtggaggatggtctcaatcagtgggatggatcaaatggcggatatttccatgataatgcacgtggatatcataatctctgggattccagacttttcgattatactcagttagttcgattgttttcttcaatatatttataatgtattaattcagaactgaaactcttcgtttcttgctctccaatgttcgttggtgggttgaggagtatgggtttgatggattccgattcgatggtgtttcctcaatgatttatcattcccatggaatgagtgagtttcctccaaaaaaaaactaaattctgacactaattaattataatttcagatgatgacttctgtgggggatatcccatgtactttggtcttaatgctgatacggactcgctcgtttatttgatgcttgctaatgacttccttcacaaaaagtatccattcatgatcacaattgctgaagaagtttctggaatgccaggaatatgtcgccctgttgaagaaggaggtcagggattcgattaccgtttggcgatggctctccccgacatgtggatcaagattttgaagcacacatctgatgaagattggaaaattgatgatattgtgttcaacttggaaaataggcgctatgctgagaaacatgttgcatatgctgaatcacacgaccaagctctcgtagga