Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T04D1.2   

sjj_T04D1.2RNAiJA:T04D1.2
PCR_productsjj_T04D1.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST04D1.2 Source_evidenceePCR703WS150 Sequence/Annotation Release
Overlaps_Gene T04D1.2 Source_evidenceePCR703WS150 Sequence/Annotation Release
Chunk_score Abs_score640
Max_abs_score640T04D1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI46815434683111
Overlaps_transcriptT04D1.2 Source_evidenceePCR703WS150 Sequence/Annotation Release
WB_DNA_textsjj_T04D1.21569agtcgcgccttatgctaaaacatcaaaataatataaatgataaacttagaagtttgtaaattcatgttaaaattcagataagagacggatggcccgtgtggggcgagcatgcctcaggcaggcgttgggcctgaaaccaagtttgcataccatggaagccctggatataacaaacccatttcagttatcccaacatgaagcttaacggaatatcatatatgtcgtatgaaaacaaaaaggagctcgaacactatttgaatgtattatataacacattttcgattgatcatctcgaccttatgacggatcgcgagaagatttttggagattacagaaaagtttttaaacatccattgtttcgtaaatgtcattatgtagagtttcacgagccttccaagttttcaacaaaagatttggaaaatctgcagaaaatgtttgatttgcataaattttatgcgcgatgtgatcagaagaaacatttcaattttcaaaaggtaacagttctatcctatgtcatttggaaacttctgtttaaactagaattgttatgtttaaactagaacaaaagtggatttttttaaaaatgtttgaaaatttttttgtgacgagctagtcaaaacataagcttttgaattttatgcttttttttttgaagtctaaaacttctttttcgtgtagaaatcttcgatcgcgttgaccctggtgttttatacttgcgtcataattcgcgatattttttatttgggtaatatcatgtctaacaaagttcagatgctgaagattccgcggattagtgtccacgaagcttacaatatcaaaatagaggacttaatgaacaacaactgcaaagaaataatattatggaataacgatttacaaatatttgaaataacaaaattcatttgtcattggttatctggaaaattgccaagccttgaaagacttcgactacatatgtttcacgattgggaaatttttgaggatatcctgattggcattgataacaaaaagagagatgaaaatcaaccgaaaacattaaagtaaacattaaaagttttcaactttcagactattttaaatattatttcagatacggagtttattccctggattgttcaaatggacgagatattattcggaaagatgggcaaattgctactctttttacaattggatatgctctcgaatttgttgtaagggatttaacattataatatgcgtttatgatatcctctagtctgtacattctgaaaaaagacctgaatgcatgtaatatgtatcctattaaagttttgattaaagatttaaaactgattttttttatttttaaattttcacaaaatcattactaaatgcgtttttcgtttttcagtgatttttcaaacatttcaaatgagtagaactctgaaaccgaaaatttcggcaagaacagttcaactaacaaactgctgctctcacttttttctgcacgagaaaatatttttcgaagtttcccaacaaacctgccaagcctgctgcgctgctgctgggagcctgccaatgcgcccgacatctagcgagcccaatttc