Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T04D3.7   

sjj_T04D3.7RNAiJA:T04D3.7
PCR_productsjj_T04D3.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW08E3.2 Source_evidenceePCR879WS150 Sequence/Annotation Release
Overlaps_Gene W08E3.2 Source_evidenceePCR879WS150 Sequence/Annotation Release
Chunk_score Abs_score879
Max_abs_score879W08E3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1333375113334660
Overlaps_transcriptW08E3.2 Source_evidenceePCR879WS150 Sequence/Annotation Release
WB_DNA_textsjj_T04D3.7910tcgagacccatcagggttactgtagtcttacctgttgctgctggggatcaaagtacacaacatcggtgggctgtcggatcctctgctgtccaccactaccaccaccacctcctccattatgttgatttcctccgtgtgtggagccgcgtgtcatttgtgggggtgggactacgttgccgggcacaacaccgacggcaaccatcggtggtgggggtccctgcacgaaacgcttctgttggtggttatggtgattattgtgatgttgtggtggaccgtggtagccgccaccgccacgtgaagcataatcagcattgtttgaggaataacctccccgtgatgatggatagacattggctgatggatgaggatgggatccaccacggaagtttgttgaagatgcttgataggaacgatcggattgatggtttggtcgaggtgatgagtaatccgtaccggatcctcctcgctgatacccttcactttgttctgaagtatcagttcttcttactccatatcttggtgctccagatcctcgaacacctcctctgatcgcaccagttctaccgtatcctccagtgccacgtgtcacggtgcctcctcctctggatgctcctcgtataacaccacgtcgatgattctcgaatcgatcatcatttcgatctccttgatggctatagtcacgacgggaagatgatgatggtggtggtggaggtcctcgagatgaagattccacagggcgtctgttgctagcagaagatggtggagctccggatgatcgtcgtggtggtcccatcggatggctcattcgtccacggagtcgagatggagggcccgacgtggttccacggcggagtggaacagcacgtcgttggccacgtcggattgcaccatcgtcctcgtcttcttcgtt