Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T04H1.4   

sjj_T04H1.4 RNAi JA:T04H1.4
PF:GL1_2E3
PCR_productsjj_T04H1.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST04H1.4 Source_evidenceePCR1003WS150 Sequence/Annotation Release
Overlaps_Gene T04H1.4 (3)
Overlaps_transcriptT04H1.4 Source_evidenceePCR1003WS150 Sequence/Annotation Release
WB_DNA_textsjj_T04H1.41109ctcaccgagtttctttgggagaagctgctgcacaggctggtgctttcgcagaacaattggaaactaagataaaagagattcaagagtgtattacggcaatctcgcaaaaaagaaatgaagatcttccggatgctcagttcaagaaagatgatctcacaagaaatgtttccagtaaagaagaagagaagaaaaaagctgaaatggaagtgcagatgatgaaaaaggagttggatcaaaaaattttccatcggaaatcgctgtttaaaaaagtccaggaaggcggtctgtgcgaaagacaactcatggataaggaaaataatattgcgttagtaatttttaaactactatagtattttgtatcaaaatatattttcagaactctgaatgccagcttagaagaaaatcagcaacgccaaaaacgtttcgaagaagatctccgttcgttcgatagttcacatcaacgcgagtcaattctaaaagatcaacttactcgaatgattatcgaaaataagataaaagagttgaaaagaacattggccacattcgatggacaaataaatgaagatcgcataactgaacaaaaacaagcttataacaaacttcaaaatgaacttcgcttgattggaaacgaagaagtgaaaatatacactcagatgcaagagtacgagaagcaaaaaaaaattgcggaagcaaaattgtcaacgaaagagtgtcagaatgctgaatcgaattatcgtgatgctatcatagaactggcaattactaaagaatctatctctgatttaacgaagtatagaaattgtcttgatgcttcactcatccaatttcattctgaaaaaatgggcagggtcaatggaatcattgatgatctatggagaaaagtatataattccacggatattactacaatcaggattaggtattttttcactactattctacaattgtttaccggtataatgtttcttttccagatcagatgctacttctgagacttcttcaaagaaagtcgcatacgaatacaatgttatgatggttcatgaaactggcaccgaagttgagatgcgtggacgctgcagtgctggtcaaaaaatgcttgcttcgttgct