Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T05A1.2   

sjj_T05A1.2 RNAi JA:T05A1.2
Simmer:T05A1.2:Repeat_a
Simmer:T05A1.2:Screen
PCR_productsjj_T05A1.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST05A1.2 Source_evidenceePCR903WS150 Sequence/Annotation Release
Overlaps_Gene (9)
Overlaps_transcriptT05A1.2 Source_evidenceePCR955WS150 Sequence/Annotation Release
WB_DNA_textsjj_T05A1.21191atgagtgataatgggaaatgtggagacatagatttggtaacacaaaatgaaaaaaaaaatgaaaaaaggaaacagtgatcaagagaaaattgtcagtataaaaggaatgggtttaacatggaaaggcatcatccaatcttgatcatctcaaaaatggaggacaacaaaatcaaggtattcacaaattgtttggtttagtttaaagttctaagaggctttagaatttaattttaaaaaccattcatgactcttatttttcgaaaattatacaatttttcaggcctaccgtctcatcgggtatgccgcagtctccctctcagctgtcggaattctttccgtttgcattactcttccactcgtttattcttatgtgagcaacctccgctctcaaatgcactctgagctccgtcactgccgtgacaccgttaacacggtatatgctaccgctgtcgctatgccagctcttcccgggagagggaaccgtaccgcgcgtcaagctggatacgatgttgccgttcaagacgccccagcccaggagcacaatagctgcgacggatgctgcttgccaggagccgctggatcagtcggagctgccggacgcccaggaactccaggacgcccaggtgcaccaggagccccaggacacccaggaaagccaccacagtcaccatgtgaaccattaaccccaccaccatgcccagcttgcccaccagggccaccaggagctccaggagcaccaggaaagccaggatccgagggaccaccaggaccaccagggcacgatggaccaaatggaggaccaggacaaccaggacaaccaggaccacacggaccaaacggacacccaggaaagccaggatcccaaggaccaccaggaccaccaggacactccgacgagccaaagccaggacaaccaggacagccaggacgtgctggaccacgtggaccacgtggagttgctggaatcaagggcaaggatggagctccaggatccccaggacaaccaggaccacgtggaggaccaggagagccaggacaagatggagctccaggacaaccaggacttccaggatccgatggaactccaggagagaagggaatctgtccaaaatactgtgctatcgatggaggagtcttcttcgaggacggatccagacgctagattttatttcgtctctcccatttttcata