Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T05E7.1   

sjj_T05E7.1RNAiJA:T05E7.1
PCR_productsjj_T05E7.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST05E7.1 Source_evidenceePCR808WS150 Sequence/Annotation Release
Overlaps_Gene T05E7.1 Source_evidenceePCR808WS150 Sequence/Annotation Release
Chunk_score Abs_score724
Max_abs_score724T05E7.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI62043266205498
Overlaps_transcriptT05E7.1 Source_evidenceePCR808WS150 Sequence/Annotation Release
WB_DNA_textsjj_T05E7.11173tgtgtcgctcgatctgattccttgggatgtattgatttatctcgtgatgcaccaattcgaggaacttatacaggtatttctacttccttcgtaactgaaagtccaattgttcattgttttaatatttccagaagttgaccaaatgggattatttatatcaattgaaccaactcaaagtatccgtccaggtcattttttcaaaacttatgacccaaaaacgtattattacacattacagtgagaatatctgtatatatctgaaaaatcaaacacatttttctcaggttattggatgattctaaaaaaatcatagatgaaattcatctgaaaaaacactggaaacatccattggttgaacaaataaatgtagaacaaaatggattatatggtacactattcaaaccacctggtaaaggaccattccctgctgttatatttattcctggatcaaatggaatgttagaaagtggatatgctgctgtattggcttccgaagggtttcttacattcacttttgcatattttgcatataaaaaggatttgccaaaattgatcccggacgttgacattgagttttttgaggtactgtgatgccagaacagtagcttcctgaatttagcaatgtcgaagaaacagggccttttgcaagtccatggctcgtgtttcctgttactttccagtttttctatagcagtgtgaatgcttcgtatattttatcacagataatcactcaaattatcaaaattaactagcaccaagcaatattacgaacttcacggagcaatctgtttgataaataaaaacgatccgccgaccaaaaaaattcaaaaagcttattgcagaaacctattgaatatgtacaaaattcaccatattgctccggaaaaattggtttggtaggacaatcatttggaggtctaactgcaaattatttgtctacaaaatatcatcaagtgtctgcagttgttgcattgaattgttcagcagcattttgtagagataatgcagttatgaaagaaaatggaaaaccaatggaaacacaaattttagatgaaggaatgtcggattttgtgaatcaagttttacgccaaaaaccagcattcagagatttgtatagcaatttgacaccgacaacaagtattccatgggcaagagcacccaagaacacagctt