Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T05E7.4   

sjj_T05E7.4RNAiJA:T05E7.4
PCR_productsjj_T05E7.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST05E7.4 Source_evidenceePCR470WS150 Sequence/Annotation Release
Overlaps_Gene T05E7.4 Source_evidenceePCR470WS150 Sequence/Annotation Release
Chunk_score Abs_score410
Max_abs_score410T05E7.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI61928126194491
Overlaps_transcriptT05E7.4 Source_evidenceePCR470WS150 Sequence/Annotation Release
WB_DNA_textsjj_T05E7.41680tctctccttcaaccttgcgtaagcctgctcgtaatgaatcagtcttacaacaagataagagcaataaaagataataacagtcaaaaagagcattgcaaacacaaagagcaccaatctcaaagccatatttggctcatcgtttgcgtgattcttttctcgtctccaggcttccatatcagctggagcatgaggtgatcttgtcgaggagaacacagttgagacaccgaaaacagcaaggaaaagagttgtaagtcctcgtgccagaagagatgggtatatcaattgatgagcatgcttttgaactccgattatcaacataatacaagtcaatccaaagaatagcatcagaccgactaggcaaacttcgaacgcggttagatcctgaaaatagtatacatagaaagccaaaagtgttactttttaaagattattttcaaaaagatggatttatgatcaaattacatattaggtatttgaatagtttgaatagttatttgaacagttagtgaaaattaataaactttcctagttttgtgagttttacactgtttttattcagcaactttttttgaaactacaaataaagcaaatagcttattagaacagcctttatgcaaaatcaatattacattattgttcaaattctcctcaactatacagtaaccaatagactacagcagggtggtggaaggatatcaattatgcttgaatacacggatgcagtgaatattttctctcaaaatactcatattagtcccacattaaatatcaatatgaaacacttcaaaaaattgtatatcattggaaattttcagtcgcaggttctggtaaatttaaatttttgaaatttttgtattttagtaagagaaatcttgcattttcgaatgccaacaatgtttagatacaagtgtttgaatcataattatgaaaaaataatcgtagaaaacagcgttttctttggcagggttacaaaattactatagctgaaaactgagtatttattagttttttgaagagattttcggtcactatagtaccatctttctctgaacagtatttggagaaaagttcttggttgtagatatacatatccagatataatttcaattgtttttgtttaatatcaacccccgtatctgttgatttgctatcaacaagcgaaacattccatctgataaattccaaagaccttttcctcggcctttgatcggtgaactcatcagtttgagccacctgacctcatgatgaaataaacatatcttcttgttgttatgagatcataaaattttatttcataatgatggatacatacctctggtttctgatggactatgttgtacattgtgatagatccagtgattgcacagaatgcaaattcaaatgaagcaagtagactcattcctggaaatgtttaattcaattattcgcttgagatacatatatttagatggcagatactgttttaaaattggaaaaattttgatttagaatacgttgttctccttccaaaaattattagatacgtatccaatatttcgcacaaaaaaagcttcaaatactccttcatttttgtctgaacatggaaaaccgtaaaaaagcgaaaacgtgggccatgagttttcctggcgggtttcttattgtagtaaaagcgtccaatgttgaaagctacaaaaaggggcc