Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T05F1.3   

sjj_T05F1.3 RNAi JA:T05F1.3
Simmer:T05F1.3:Screen_A
Simmer:T05F1.3:Screen_B
PCR_productsjj_T05F1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T05F1.3 Source_evidenceePCR507WS150 Sequence/Annotation Release
Chunk_score Abs_score444
Max_abs_score444T05F1.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI96250059625935
Overlaps_transcript T05F1.3.2 Source_evidenceePCR499WS150 Sequence/Annotation Release
T05F1.3.1 Source_evidenceePCR507WS150 Sequence/Annotation Release
WB_DNA_textsjj_T05F1.3931taatttgcgccatcatcttactttcttgttaatggagatgtatcatgaagttttttataacaacaacatttataacacaaacaacgagtgtttaggcttgttgtccagaggatctgaggctggtggcgattctgtcaagatccttgcgtccctgcaaaatttagttttagtacgatgttgaaaatttcgagaaaattcaaaaaagaaaacatgcagaaatttaattttaatataaacatctaattttgcatgtttaattttcagcgcatatatttatgaataatttttaataatttatttttacaaaaaagttcgaattttatatttttagataataaaatagaatactcacctgcttggagagaattcttcctttgccgtctgggtgcttctcaacccacttgatcttctcgagttgctgaacagcctttctgaggcagtttccagctgaggtttggaaatggtttggtgcaacaccacgtctcttgtttcctccgtagaccttcttgaaggctccgattcctaaatagaaaaataagtaatgattttgtcaataaaaagttaccggcggggcggaaatacaagtgacgagcaagactggcagcacgggtgtagaaccaatctggatcgactggggcaagctccttgttgactccgagcttaacaagatcggaccactctggaaccttaacctttccactcttcttcaagaagtgagcgatggacttggtagcctcgtgctggtcgacgtccttgatggaggtcgctctcgtcattttacctgaaaaggaaaagtatagctttgaaaaaatcgtatattagaagacggaaagaaaacccactgccaaaaaaactattcttaacaacaagcgcttcagaaagtggatattatttaagaaaactgtaaacgtaacatatttcctcccaatca