Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T05F1.8   

sjj_T05F1.8RNAiJA:T05F1.8
PCR_productsjj_T05F1.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST05F1.8 Source_evidenceePCR1033WS150 Sequence/Annotation Release
Overlaps_Gene T05F1.8 Source_evidenceePCR1033WS150 Sequence/Annotation Release
Chunk_score Abs_score970
Max_abs_score970T05F1.8
Specificity_index0.713
Rel_score1
Map_statusUnique_ePCRI96425679643691
C33F10.12 Chunk_score Abs_score391
Specificity_index0.287
Rel_score0.403
Overlaps_transcriptT05F1.8 Source_evidenceePCR1033WS150 Sequence/Annotation Release
WB_DNA_textsjj_T05F1.81125tgttcatcagctgccacttctgttgctgctccgattgaatttggctccagtcaattctatgcaatgtgtgctcttggaggatctctttcctgtggattgactcattttgcaatcactccgttggatattgtcaaatgccgtattcaggtatcatccaaggtctattttttattgttaccaatattccaatttcaggtcaacaaagaaaagtatggaagcatggtgcaaggttttaaagtgaccatagctgaggatggagttcgtggtcttgctcgtggatgggctccaacattcattggttattcggctcaaggacttggaaaattcggattctatgaagtttttaaaaacatctacagcttgtctttaggagaggagaatgcctatatttggagaacttcgatctatcttgccgcatctgcttctgctgaattctttgccgacatcttcttggctccaatggaagcagtgaaagttcgtatgcaaacatctccaactgctccaacaactcttcgtgcatgtgctccaatgatttacaagcaggaagggctcactggattcttcaagggactgccacctctttggactcgccagattccatacaccatgatgaagttcacttgtttcgagaaaactgtggagcttctctatcagtacgttgttccaaaaccacgtgctcaatgctcaaagtctgaacaattggcggttactttcacagctggatacattgctggtgttttctgtgctgtcgtgtctcatcctccagatgttcttgtttcaaaactgaatcaagattcaaatgccagtgttggaagtcttgtcaaacaacttggattcaagggactttggggaggacttggtccaagaatcattatggttggaactttgactgctcttcaatggttcatctatgattcgttcaaggtaaggttctctctttatctttaaacttatctcacttgtttcaggttgcaatgaatcttcctcgtccaccaccaccacaaatgccagaatctttgaagaagaagcttggaattccgggaaccactgaagttgctccagtcgctgaaaaagttgctgctccagagaaaaacgcaaaatgtgagaaaccaggaaaggtcgaca