Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T05G11.1   

sjj_T05G11.1RNAiJA:T05G11.1
PCR_productsjj_T05G11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST05G11.1 Source_evidenceePCR1150WS150 Sequence/Annotation Release
Overlaps_Gene T05G11.1 Source_evidenceePCR1150WS150 Sequence/Annotation Release
Chunk_score Abs_score1108
Max_abs_score1108T05G11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1592945015930647
Overlaps_transcriptT05G11.1 Source_evidenceePCR1150WS150 Sequence/Annotation Release
WB_DNA_textsjj_T05G11.11198tcatttgaaaacaatccatttccaacgagtatctgcacagcatctgtacagattttcaaattcttcttgaaatccatcctcggagtcttcagagttgatgctggacctgaagatgtagtagatgccgctgagaagtcgggatattcttgggcttcactctctttcaaagattggagaatcgaatcggcagccattcttggtatggccaccggtttcacgttcctcgcgtctccagccttcttcaaacattcaacatgggacatcaagcaacgtctagtggcaaaagaccagttacagcaccgacagttgaagaccaatcggatgttatgctctttttccatgtgctcctgaaccgtcacggtcttcggcatttggtgattgcacaagacgcacacatgtccagacatgtggatctgacgatgatgtttgcttaatgatctttcactatagaagaattttccgcatgatttgcaagacagcctggctgaaaataattgacttccagcggcagaatcatcatcgccgctttgtgtttcggtctttaatgtgaaaaattgacgaatcgaagcggttcttggtatagccaacggttccatgtgacctggacgacaacaaggtttgccagtttgtttcaagcatgttttgtgggaaatcaagtgtacttgattcaagaaagtccaattacaacagaggcagttgtagaccttcttgatgttatgttggctcttcatgtgatctcggaccgtctcgttctccggaatttggcgattgcacaagaggcacgtatgacccgtcatgtgaaatcgacgccgatgctctcgtaaagagccttcgtgaaagaaatcttttccacagaacccgcatggtattttttctaaaaacaaactggttgagctttcgttagattaaataaaaaaattacctctgggagtacccgaaactaatgttcttggagtcgaagtagacgctgaagagcggtcggcagattctataggttccatcttcaacgaggacgcttgaataatcgaattttcggcgatcattggtacgggcgatggggagctgtgaggaacatcatcggaaccattttgtggatcagtgttcaaggcagaagcttcacgagccggtgcagtcataggcatagccaacggtttcagcaaaccaggacgcccagtgcttttcatacattcttcatggc