Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T05G5.4   

sjj_T05G5.4 RNAi JA:T05G5.4
Simmer:T05G5.4:Repeat_a
Simmer:T05G5.4:Screen
PCR_productsjj_T05G5.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST05G5.4 Source_evidenceePCR225WS150 Sequence/Annotation Release
Overlaps_Gene T05G5.3 Source_evidenceePCR75WS150 Sequence/Annotation Release
T05G5.4 Source_evidenceePCR225WS150 Sequence/Annotation Release
Chunk_score Abs_score162
Max_abs_score162T05G5.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII97486739749474
T05G5.5 Source_evidenceePCR7WS150 Sequence/Annotation Release
Overlaps_transcript T05G5.4 Source_evidenceePCR225WS150 Sequence/Annotation Release
T05G5.3.2 Source_evidenceePCR75WS150 Sequence/Annotation Release
T05G5.5 Source_evidenceePCR7WS150 Sequence/Annotation Release
T05G5.3.1 Source_evidenceePCR75WS150 Sequence/Annotation Release
WB_DNA_textsjj_T05G5.4802gattatttggcccttcgatattcatgagtaatctcttttttcacaccgcgataaataaattcgctctactttcatgctcttttttattcaagcactttgttcaacgtgtaaatgagaatagggaattaagaattcattattattatttttccattctgaagaatgatcgctgcagtgattccaatattcgtaatttctctgtctaacatttcgcacgtaagctaaggtaacgaaaactaatctaactggagctattaagattattcttgcaattttcttcttcccatcgattgtagaattcctcgatgatctttactggggattcacttatcgttcgtggtctccaattgcacgtcaattagaattgggaccggtaggatatatccctatatataggattaaatacaatttagagaataaatcaaaataattgtgtttagaacatttacattcatcactcgaaggtttctattttgatggacaaagctgatctttatgagaagaatcagtctaggaaagatattttaaactattaccgggaaggtattgtttaatatttattcattctctcgaatatctgaaatttcagaagacaaggattttgagcagtatttgaattttagagaaaatcgaaaaatgttgcaacaagcttttgaaagcggaactttgattcgaaaacaaaagtaagatattacatttctctaactttccagctgtcattataatttccacttgcagctaccgtgcccggattcacgagagaatggttgaacagcctgtaaccgagaagaaagaattgctg