Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T06G6.1   

sjj_T06G6.1RNAiJA:T06G6.1
PCR_productsjj_T06G6.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST06G6.1 Source_evidenceePCR879WS150 Sequence/Annotation Release
Overlaps_Gene T06G6.1 Source_evidenceePCR879WS150 Sequence/Annotation Release
Chunk_score Abs_score774
Max_abs_score774T06G6.1
Specificity_index0.426
Rel_score1
Map_statusUnique_ePCRI1270356312704711
F28C12.5 Chunk_score Abs_score626
Specificity_index0.344
Rel_score0.809
F28C12.2 Chunk_score Abs_score418
Specificity_index0.23
Rel_score0.54
Overlaps_transcriptT06G6.1 Source_evidenceePCR879WS150 Sequence/Annotation Release
WB_DNA_textsjj_T06G6.11149ctagcaattcaagctctttggaataataatatattctcaaattcaacaagactaattttaatagtgtgtttgctgaattcagtcgttcatcagacgacggtgatggagacacgggtttgttttgtttttttttcaatctcagctgttgaaatctttttttaaaacatgataaggtaaaattgtttgagattgaaacatacatttttacagagcttcagacttctttttaactatttataaattagatttcagatcacccagatataccgaagcatcgtgtttgcctcagaaccttgcgagatattattccgctcatcagagtgtgaaattgaactgtacttctattacctcacaaactacttttccacgtattcagttttctctctcacgtttgacaggttagattggtctttcacgcgcatagaattcatagagttttagattgatatctcactacaagtcaaaatactaccacatgcatcaatactttattgcgatatccctgctagtcctccagtttcttctcgcaatcttatcattttatattgcataccatggagtcccactagctggttatgtgccaatgtgcaactactacccaaaaatggcggtacaccatatcactattaacgacgtacgcacggtagttatggtatcatgcattatagtcacggggttcgcatactatcttagtgtaaagtcagagaaacagtgagtgcgctaaagtttacaactcttctaaatatgttttgtcttagaatccagaaatgcagttattcccctggagaacgatattctgcatatgagaatgttacaacatcgcaatcagtgtgcatattaattgttcttcaattctcatgcaccatgatatcgtcattcggagtgaatctgctcttgatgatgcaagaagcagtgtcagaggaaacattcacaaaagttggtgcgttccttccggtgagtcgattgtttttttactttccatattccgattttcagggagtagcctacgcgaatctatgccttccacttgccatctacttcaagacaaaactaactattcaaaacaggaaattacgaattgcagtaatgatatcaatgtatggagatgtcggagaacatattgctcggctgaagaagagttgggaatat