Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T06G6.6   

sjj_T06G6.6RNAiJA:T06G6.6
PCR_productsjj_T06G6.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST06G6.6 Source_evidenceePCR740WS150 Sequence/Annotation Release
Overlaps_Gene T06G6.6 Source_evidenceePCR750WS150 Sequence/Annotation Release
Chunk_score Abs_score603
Max_abs_score603T06G6.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1271815812719738
Overlaps_transcriptT06G6.6 Source_evidenceePCR750WS150 Sequence/Annotation Release
WB_DNA_textsjj_T06G6.61581taccagcacttcccaaaaccttccacctttcaccagccgcaaaaccggtttccacttcacgcctgttcgaaaaaagaaactgagaagataaggaaaagccgaatggcttctcgaaatgaggtcagatgacggatagagataccgggtctcggaaaaagactggataagtgttgagacttttgggcattagcattcatttctattattcaccatgacgagaaggttgatgatagccgctgccgcattgatttgtggagtctatgcgcaaggtgagttatagagattgtttgataatgtacatatagtttggttccttttaatcatatctggaaaaacacttttttttctttgatattggtaacaaagacattaactaccaaaaccgagatcagcgaatttcaaatttcaacttgcagcctagattcattctgaagacatatttgaaatgtatgtgattataaattatgcccattgacaaaattctgcaaaaaatatacacgccgggtgtgcaatgtacaaagcaagtctctgctcatgttcaacaattataccacaactaatatttttcttcattctctagtaacttcaaaatttagacacctcctcgtggccccaatttcaaataatcggcaaccagttagaaacctccgagaaatggcatagatatggtgttctaggtattcatacattaacgtgtgtgtgcacagcttaaccatctagttttgagttgctactcagctttttgacttttccatttcatgctcctcatttttaaatcgctcagctgaaacccgagaatatgcctgccaacgtcaatcctcgagatcttcaaagtcagaatgtatgttaagatttggagaggtgtctgctacaattaatgataatgggtgctttatggtaagctcacggctttttgccttcaggtctaaactataatttcagcactttgactcaaagaagctagaatcaattgagctgtgtccacttcaatgccaaaggttcaatgaggccactattctgcaggtgattcttataaaatgttaaaaaattttcagtcagaaaactggattttcagacctctgactctttaatctgctctccgggagttgctgtcggagttgaaagacgacaaagtgattggtttatgtggagaagtggggcttgtaaatccagcgatgtcatcttccagattgagtgctccacaaaacagtaagcttttcggtttctgctctgaaaatacagaactgtggacttgcagagctaaagaacaagatcagatggtggaggttcccgaggaggttcaggtggtcgaggaggagattccagtgatgaagttggagacggacaatgggattcaggaagagtaagttcttcattacctcgatcccattccctcaagttgtttcttttcagaatgacctcatcaattgaagacattacgtcaggaaccgaaaaaaccaccgtggagcagtccacgactcaaaaaccagaagtttccgagcaagaagatgatcttccagagaaagtcgatacgctcctagggttcctgtttccatcatacagaaagaaggcattgagcca