Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T06G6.8   

sjj_T06G6.8RNAiJA:T06G6.8
PCR_productsjj_T06G6.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST06G6.8 Source_evidenceePCR997WS150 Sequence/Annotation Release
Overlaps_Gene T06G6.8 Source_evidenceePCR997WS150 Sequence/Annotation Release
Chunk_score Abs_score955
Max_abs_score955T06G6.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1272515212726221
Overlaps_transcriptT06G6.8 Source_evidenceePCR997WS150 Sequence/Annotation Release
WB_DNA_textsjj_T06G6.81070tgtgctcaactattgctcggagctcagcagctaccttcagtacttcccgatgttggtggaaatcgatcaggatctcaagagctttgagtgtctggcacattcctcggaaaacctgaataaattggatgctcttagtgtttataactattatgatacgggcagacaagcaaccatcatgtcagttaacggaagcaatttaagcgtgaagagcagtcatgcgagagattggctcggtgctcctttgatgaggggatcagttgtgatcggaatctcaattggacgtgagttgttgagaagatcttacgagcagcttaaatttcttttaggatcacctacaggagactcggcatggttcctgaagccggacaactatgcgctttgtggattggctggaatttgtgaaggcccggctcaaacttccacagctccttcaactagatcctctaaacttcccacctcatcggtttggaaggcaacaactacaccttctgatcttccaaccaagccttcaagaacccgatcattgacctcaacgagtactactactgcaaagcttccaacaacaacatccaccaccttcgcagctccacaagcttccacggaaccatcggaggcaacagaagctttagcaacggctacacctgctgatcttccaaccaaaccttcggggagagaaattactacgatcacaggcactcgaaaattgagctcaacgagtactacaaagcttccaaaaacagcatccaaaacatccacagctcgactagcttccacggaacactcggaagccgcaggagctccagcaacggctacaccttttgatcttccaaccaagccttcaacaagtactacaaagcttccatcaacggcttccaccacctccgcagctccactagctttcacggaaccctcggaggttgcagaagctccagctaatccagcggatcatgaagaaactgaagtccttccattggcaagtggagcctcgaattggaacttaacgttttggattttgtgtttttatggaataaagtacttttagttgggatttttttgtgctccgagagctt