Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T07A9.8   

sjj_T07A9.8 RNAi JA:T07A9.8
Simmer:T07A9.8
PCR_productsjj_T07A9.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST07A9.8 Source_evidenceePCR881WS150 Sequence/Annotation Release
Overlaps_Gene T07A9.8 Source_evidenceePCR881WS150 Sequence/Annotation Release
Chunk_score Abs_score755
Max_abs_score755T07A9.8
Specificity_index0.588
Rel_score1
Map_statusUnique_ePCRIV396493398769
T07A9.9 Source_evidenceePCR5WS150 Sequence/Annotation Release
C14C6.11 Chunk_score Abs_score69
Specificity_index0.054
Rel_score0.091
K07E8.12 Chunk_score Abs_score314
Specificity_index0.245
Rel_score0.416
K10G4.7 Chunk_score Abs_score74
Specificity_index0.058
Rel_score0.098
F41H8.3 Chunk_score Abs_score72
Specificity_index0.056
Rel_score0.095
Overlaps_transcript T07A9.8 Source_evidenceePCR881WS150 Sequence/Annotation Release
T07A9.9a.2 Source_evidenceePCR5WS150 Sequence/Annotation Release
WB_DNA_textsjj_T07A9.82277ccgttgaatttttcgctgtattagaaaaactattttttaattaactcttcagatgggcaaaaaaagaaagattacggatgaaaaggatgctcaacacgtgccagctgagaaacgagaggttaatatcacattttcaaagaaacgtagttctcaaacacaaattaattgcagaaagtagaaaattggttaaagaaatctacggaaaaaccaacaagttcacaatctgacgctgaaaagaaaaagaaacgtccatggcgtaataaggtccgtaaacttgccgcaaaaaaggcagcagctgacaagaaatctgaaaatccagaagaacctccgctgattctcgaaccaaagagttcttcggatgaaaatacgaaaaagaagagaaaacggggcccaaaaaagaagaagttcaagcccgaagttgctggaaaagctgctgaaactgaaaatgatgacgtggcagcagctccagaagaagcagatccaattgcagaggctaaaaagagacttgacgcgggacgattcagatttctgaacgaaaaactctatacatgtactggttctgaagcatttgatttcttcaaggaggatccgacggcttttgatctatatcacaagggatttgctgatcaggtaaacattaattggtatctcagtttcacaacgaagcctttaaaatgatatatgtgccatttgaaggtgttccaagagtatatgttaaaggtggagtagcgccagtggggaaattgctttaaaacatgcaaacatatggtaccacaatgaccgaatatcatgataaaaaaattcaaaaattttttctaaattttatatgattttttgaaaattgaaaaaatctcagtttttgcctaattcctatttgaattaccgccaagtggatttgttcgatgaagcgcgcttgcacgtttttaaatttatttattttgttttttgttgttttccaccgatttttaatgttttcggtgtatttttgctcgagttttagagaaaaagtcaaaataaatgaaaattttcgattaaaaagcacgcttttctctaaagttcgagcatacaccgaaaagaatacaccgaaaacattaaaaatcggtgaaaaataacaaaaaataaaataaataaatttaaaaacgtgcaagcgcgctccatcgaacaaatccaattggcggtaattcaaataggaattaggcaaaaacagatttttcaattttcaaaaaatcatataaaagttagaaatttttttgaatttttttatcatgatattcggtcattgtggccccataggcatgttttaaagcaatttccccactggcgctactccacctttaatgcaaaattttaaacgggaaagctatactctcaacccctaaaatgagcgagaaaactttgtcttgtcagttgtgaactctcaaattttcaggtaaaaaaatggccaaatcacccactccgcgagattatccgctggcttcaatccaaaccggatcaacaatcagtattcgatttgggttgtggagaggctaaaattgcagaagccgttggagaaaagcataaggttcatataattccctggaaaaatcacattacatttctcatgttttttaatagattcgctcattcgatttggttgcagtgaatgatcgtgttgagtcgtgcgatatgtcgaaacttccagctgaagattcatcagctgatattgttatttattgcctatcactgatgggaacaaatctttatgattttattcgagaagctcgaagagttcttaaaattgggtaaacaagcatttcaatttaaatataagcagacaccgtaaccgagagtgcctttttcgatttatcggtgtttttcagggaaaatcgaaaaatcagaaaaataaataaataaatacaaccataaattcgatttttgtcggtggttttttgggtgaggttctcaggattcttgggtgaggctaggaattaagttgatgtcacgggtggcatttttcactttttcgatgtttttcaggaaactaacatttttcgattttccggaaaatcaaataatcaaataaaaatgttcagaaatagtcataaaataccatttttaccaaactttgcttatattgatgagaaaaaacataaaaattcttctgtaaagaagagaaaaaaccaaattttcaaactaatttttgaaaaacagaaaatttatttgcaaaaatcaatttttcagaggaattctcaaaatcgcagaagtcacatctcgtttcgtgtcaatcaaacaattttg