Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T07A9.8   

sjj_T07A9.8 RNAi JA:T07A9.8
Simmer:T07A9.8
PCR_productsjj_T07A9.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST07A9.8 Source_evidenceePCR881WS150 Sequence/Annotation Release
Overlaps_Gene (6)
Overlaps_transcript (2)
WB_DNA_textsjj_T07A9.82277ccgttgaatttttcgctgtattagaaaaactattttttaattaactcttcagatgggcaaaaaaagaaagattacggatgaaaaggatgctcaacacgtgccagctgagaaacgagaggttaatatcacattttcaaagaaacgtagttctcaaacacaaattaattgcagaaagtagaaaattggttaaagaaatctacggaaaaaccaacaagttcacaatctgacgctgaaaagaaaaagaaacgtccatggcgtaataaggtccgtaaacttgccgcaaaaaaggcagcagctgacaagaaatctgaaaatccagaagaacctccgctgattctcgaaccaaagagttcttcggatgaaaatacgaaaaagaagagaaaacggggcccaaaaaagaagaagttcaagcccgaagttgctggaaaagctgctgaaactgaaaatgatgacgtggcagcagctccagaagaagcagatccaattgcagaggctaaaaagagacttgacgcgggacgattcagatttctgaacgaaaaactctatacatgtactggttctgaagcatttgatttcttcaaggaggatccgacggcttttgatctatatcacaagggatttgctgatcaggtaaacattaattggtatctcagtttcacaacgaagcctttaaaatgatatatgtgccatttgaaggtgttccaagagtatatgttaaaggtggagtagcgccagtggggaaattgctttaaaacatgcaaacatatggtaccacaatgaccgaatatcatgataaaaaaattcaaaaattttttctaaattttatatgattttttgaaaattgaaaaaatctcagtttttgcctaattcctatttgaattaccgccaagtggatttgttcgatgaagcgcgcttgcacgtttttaaatttatttattttgttttttgttgttttccaccgatttttaatgttttcggtgtatttttgctcgagttttagagaaaaagtcaaaataaatgaaaattttcgattaaaaagcacgcttttctctaaagttcgagcatacaccgaaaagaatacaccgaaaacattaaaaatcggtgaaaaataacaaaaaataaaataaataaatttaaaaacgtgcaagcgcgctccatcgaacaaatccaattggcggtaattcaaataggaattaggcaaaaacagatttttcaattttcaaaaaatcatataaaagttagaaatttttttgaatttttttatcatgatattcggtcattgtggccccataggcatgttttaaagcaatttccccactggcgctactccacctttaatgcaaaattttaaacgggaaagctatactctcaacccctaaaatgagcgagaaaactttgtcttgtcagttgtgaactctcaaattttcaggtaaaaaaatggccaaatcacccactccgcgagattatccgctggcttcaatccaaaccggatcaacaatcagtattcgatttgggttgtggagaggctaaaattgcagaagccgttggagaaaagcataaggttcatataattccctggaaaaatcacattacatttctcatgttttttaatagattcgctcattcgatttggttgcagtgaatgatcgtgttgagtcgtgcgatatgtcgaaacttccagctgaagattcatcagctgatattgttatttattgcctatcactgatgggaacaaatctttatgattttattcgagaagctcgaagagttcttaaaattgggtaaacaagcatttcaatttaaatataagcagacaccgtaaccgagagtgcctttttcgatttatcggtgtttttcagggaaaatcgaaaaatcagaaaaataaataaataaatacaaccataaattcgatttttgtcggtggttttttgggtgaggttctcaggattcttgggtgaggctaggaattaagttgatgtcacgggtggcatttttcactttttcgatgtttttcaggaaactaacatttttcgattttccggaaaatcaaataatcaaataaaaatgttcagaaatagtcataaaataccatttttaccaaactttgcttatattgatgagaaaaaacataaaaattcttctgtaaagaagagaaaaaaccaaattttcaaactaatttttgaaaaacagaaaatttatttgcaaaaatcaatttttcagaggaattctcaaaatcgcagaagtcacatctcgtttcgtgtcaatcaaacaattttg