Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T07C12.1   

sjj_T07C12.1 RNAi (5)
PCR_productsjj_T07C12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST07C12.1 Source_evidenceePCR786WS150 Sequence/Annotation Release
Overlaps_Gene T07C12.1 Source_evidenceePCR786WS150 Sequence/Annotation Release
Chunk_score Abs_score681
Max_abs_score681T07C12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV99379349939412
Overlaps_transcriptT07C12.1 Source_evidenceePCR786WS150 Sequence/Annotation Release
WB_DNA_textsjj_T07C12.11479cctactgggggctacattgataaagttcccaatcagatttttgatttgtggtacatttaagtttactactagaaaaaatacaatctaattagatatagagaagaatatagagaagagcaatttcttagtttatgtaacattcaaaaatatattattggctaggtgttcgaaatatttgaggaaatgtttttttacaattatggaagctcaatttggacagagttctttgctggtctgatgtgatgaagaatacgatttcttaaaacaggaagacaaagtataattgccaatggatcgcagaatggaaatgcagcgagagcaattacttcgagatagtttaatcctctgaaatcaatacaattttacttagatccgaagattataaggagtaccttcccaagtttatattgaaaattggactgtaccagcagagtacacatggtgcataactgacacaaattggtatgattgtttgaataattagagattttagtaaagctttctgtagcttggtggtgcttgcactcattcgaaatgaattttcgtttagcttacgcattgtctaaaatggtttaactttattttagaagttcaagtatacttactaaagtaccaaaaacgatatataaacttatcgataacgttgaaatgacggttaccgcacaaagtgtgaaccatgatcgtgatacaattttatgtgaggcttcctaaattttatgaagttagatgtttttcgaatagttatgttggtcatcagatattatagtatctcgattttattggaacagtcaggctgatcataaaaactttttttaaataagttggcaggatccaaaaaaaccaaagattctataaattcaatgtagacattcggcaacaacttctatttgaataatgttttggcaatttttcaaaattgttaggcctgcgttttttttggcttgttgcacttgcggccgatagtcaaaatgagaatcgaaattataacaaatggcagacttacattgtacaacaacgagaccaagttggttgttgtgcaattttctccataatcatggagaaagttttcgccaatgtaagctttaacttcctcatcagcaaatgcaaatctaataccaaccttaaaagttaacctgtgatcaggaaattaactaagcattcactcactccgtaccaatatacaaaaaagaatataaacatcatgaccgttccgagcatataaagtttaaaatgtgcagatataaaagcgtttcgaacaacaagatatcggtaaaggaaatggcttaaaagaattgcataacttccagaaatcattccacatcttgcaataagcatatttagtccaagagttgatgattcaaagaagtagccaccatttataaacatatagaaacaataccgatacgtgtgaacatccttaaaactagggttgttatgagggacgtcccatctcgtcttcctcgatttttgagagccgac