Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T07C12.5   

sjj_T07C12.5 RNAi (5)
PCR_productsjj_T07C12.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene E03H4.8 Chunk_score Abs_score152
Specificity_index0.096
Rel_score0.12
M142.7 Chunk_score Abs_score100
Specificity_index0.063
Rel_score0.079
W05B2.3 Chunk_score Abs_score68
Specificity_index0.043
Rel_score0.054
T07C12.5 Chunk_score Abs_score1267
Max_abs_score1267T07C12.5
Specificity_index0.798
Rel_score1
Overlaps_pseudogene T07C12.5 Source_evidenceePCR1309WS150 Sequence/Annotation Release
Map_statusUnique_ePCRV99441469945832
WB_DNA_textsjj_T07C12.51687acggagcctggaactgactagacttgttataaaattaattgcttggatgaacgtatccatttttaagtttgaaatttcaagaaaagattaacaatggaatcattgattaagttttcgtcagttaaaaatcaattgagagcacaatttttagtaatatttgtctttgattttttgaagagaacacgtttccggagtggaggaagacagagaataatggccaatggatcaaaaaatggaaatgctgaaagtgccaatacttcaagatagttaaatcctctgtaatatttaaattatagccaaatgaatccggatatcttgatttaccttccaagattaatgttgaaaattggactgaaccaacaaagaatacatggggaaaaaatgacaaaaatcggtataattgtctggacaattaaagctttaagaagagctttttgaatggttgttgtggttttactcatatgtaacgtgttttcggtcagtttgctcattgtctaaataatcagaattgaattaaattacttcaggatttaactaaccaaaaagccgaagattgcatataaatcaatagaaaataatgaaattcctgcaactgctatccaagatcttatgataacgtcgtctgatgcttcctagaaacaagataattggttcaatctgttgtggtatgaagcaggggtgtgcggcaaatctcaaaatttgccgagctcggcaaattcggcaaattcggcaaatttgccgtgcttaacaaactcggaaaaattatatattttttgatattttttggagcatcaaaactactgaattcttaacacacctctggtttctgaacaagttaggtgtagtgtgtctgcttaaacatcaaaataactcaatttgttgtcattttactaaatttttggcgaaaaaatcaacagttttagtcaaaattgtactgtcaaatttttgacgtgtgcggcaaatttcgaaatttgccgagctcggcaaattcggcaaatctacttttttgaaatttgccgtgctcggcaaattcggcaaattcggcaaatttgccgcacacccctggtgtgtatgtcctggaagttttgacgattttcagtttttgggaaaattgatcttagaaagaactatgaagagcaaaggaagaagttgtgaaaaaaagacattactattggtacgactatggtcacaatggagtagaatatgttgaatagtgcaaaaaatagcagaagatatcgataatggccaaacttgtttgatttttccgtaaacagcaaatacacaaaaattggatttattataaatgcaaaggaagcaaagatttttggaatatagtgatgagcccagtttatgtacattttgatgatggaatgaaatgagaaatgatgatgtgaaaacaatacacctatagtttttagttttctgttttaaaatcatgtgagctgaccctagagatttaaatataaactagaattctaccggaggccgaggttggcaagaacacaagagtcctgaagttggaaaataagtttgattaatttcggaactttatttcattttgccattccaatttgttctcatcattgactcatttgaatgattatgagctgcaaatatctaaatgtaaattgattcttgaacagtaagtcaaccaactttgacactttctgcccgaaaaatggtaaaa