Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T07C4.1   

sjj_T07C4.1 RNAi JA:T07C4.1
Simmer:T07C4.1
PCR_productsjj_T07C4.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T07C4.1 Source_evidenceePCR1072WS150 Sequence/Annotation Release
Chunk_score Abs_score1030
Max_abs_score1030T07C4.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1035613010357256
Overlaps_transcript T07C4.1.1 Source_evidenceePCR1072WS150 Sequence/Annotation Release
T07C4.1.2 Source_evidenceePCR1072WS150 Sequence/Annotation Release
WB_DNA_textsjj_T07C4.11127cagacactctcgtctgagtgatgaatccagaaatcacgtcacgattctcgttggcaatcttgacggcggtctcggtgtatccttccagcgcagtcaaagatcctttggtgctgagctgcgcgatgaggagaactccactgagcctgtaagtcggatctttggcgagcttcctgaagactcctgcaatgctgtcacttccttgtacggcatgaacagtcacaacatccgcccagttggcgattttctgggctccagtgagctgaagaaggttcgtgtttccagtgtcgccaaacttccgatcctcgaaaatgataaagtccatatcatttgccatcgtcgtcagcttcctcgtgaattcctcgttgaaatcggtgatagcgtcggcgtgaagcttgatcgccagcacaaatggaccagcgagctcgatcatctgaaggcactgctcgacggtagtgtagtcgacagcgagacacagattcgacttcttccggcgcatgattccaagaattttcttgatgagtgcagattctgtgagggattcgcgttccgcaagcggagttcgcacgttttccacgtacggtagactggacaggttttcgagctcgctgttgatttccagctttgttggggaggtgtacggaaggttgagagcctgaaataatcaattattttatttttaaatagaaaatcgagataatttgactaacctgaacaattccgtgccactgctcgtcaccgatcgctccagttgagtacaagaatgtgagaactgtttgcatgtcgagcaggctgtgcagcgtgacacccgcgtcctggagcttctgacgcccgccttgttctcgatccagaatgcaaaatacatccgaggcgaccaaattctctgtgtgaagcacttttaccacgtccaggatgcttccacctgtcgtcacgacgtcttcgatgaggatcagacgatcgtttggctggtacaatccctcgatgagcttcttcgtgccgtaggacttggcctctttgcgaacgatgagcagcggcttcttcagatagtttccagcggcgactgatgcgtagggaagagccgcgtatgggattccaagaactccagcgtactgaacctcgctaatctccac