Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T07D10.1   

sjj_T07D10.1RNAiJA:T07D10.1
PCR_productsjj_T07D10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST07D10.1 Source_evidenceePCR774WS150 Sequence/Annotation Release
Overlaps_Gene T07D10.1 Source_evidenceePCR887WS150 Sequence/Annotation Release
Chunk_score Abs_score825
Max_abs_score825T07D10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1260368712605707
Overlaps_transcriptT07D10.1 Source_evidenceePCR887WS150 Sequence/Annotation Release
WB_DNA_textsjj_T07D10.12021aaatcgataactccttttgcctcaaaattttgcaatattttctaagtttactttaaaataaattaaagaaattcattttcctgagcttgacgcaaaatttaacacaaaaatcgataatgtctcgagtacacgtaaaagttttgaatcttcaaaaaaaaagactgctacagtacccctacagtaatctacaatttagaagagttaacaaataatgaataataatttggcgggggaatttcatcaattctagaaattaggtcagttcttgtataaccgaatacggtagcataagcgggagggtcttctggcgttgccacgtcatcgggctccaattcctcttctgatgatgacgtcatttctggagctgatggtaccggtggcaggagtaacggcgagtgacgtcgtctgccacgtggcgagataaatcgcttgacaccgggtcctggaacgaaaatatttagtttttttatggcaaaatttaaactcagagtataatcacacccatgtttggaaaaattgggtcctggcacgaaattactgtagcttgggagtgtttaaaggcgcagagagtcgtgaattttcaaattctaggcaacttagtcgtgattatacttgaatgaaagctcttttttcgttgattttgaaaactgtattttcgagggtctcggctcgaaaaccactgggttactgtagatttttgatgaaaaatggtttcaaaaagtttcgaaaatccataacaccgtcaattttcaagattttttgctaatttttgtcatataagattggtgataaattgagttaacagtaaaaaatagtttgacctagatttagacaaaatttcgtggcgggaccatgagaaaaaccatgaattttcaaaatgatccaaacctagtcatgtttatacttaaatgaaagctcttttcatgctgcattcgttgattttgaaaactgtattttcgtgggtctcaccacgaaaaccactgggttactgtcgatttttgatgaaaaatcgtttcgaaaagtttcgaaaatccataactctgccaaattttgtgataatttgaaaatttttgttgtataagattggtgataaatgatataataagtgaacaattatttgcctagtttcgagaaaaattaggccatcaacgcaaattctaggccatcgggcgatgggtgcgtttcctcctccaatttcagttttttttattaggttttatgggaaaatttagaaattcttgaatattttttgttggttaaaaaattatgaaatttgtatttaaaagcaattttattttggaaaatttttaaacgaatttttaaaaattttcagaattaatttcaagttctatgtttcgttttctattaattaagaattttttagaaacccaccaatcaggtcaaaaataagttcatccggcaggtctccaaagtaccacggctcattgggtattcgtaggtaaatgcagatccccgccaggcaagtgcaccgcctgttatggtaaaacgttgcctgaactcgtgccgagaccatcttatatgtgtaatggaactccgagagtattgtcggacacggacagtagggcgccggcggggtgcactgaaattcgtggaaacgggctccggtcaccgagcaccacgtgggaatacacacggcgacagtgttctcgggtacgtggatctgtggattttcgagcagcttccgcaagagcctctgcacttttagacggtcttgactgtagatttgtggattcttggagctctgacggtagttttgtgctccacagaagaaggtgtggctgggcgtacggattgtgtgcaggccgggaatgttctcgaattggtggagtgtgttgggcacttttcgttcacgacgcagctttatttggtagtagatttgatggagaagctggaaaattttaaattcggtagtttaggcttaggcttaggcttagaattaggcgtaggtttaggcttagaccagttttcaaagttatgtatttttccgttggttttgagaa