Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T07D10.2   

sjj_T07D10.2RNAiJA:T07D10.2
PCR_productsjj_T07D10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST07D10.2 Source_evidenceePCR790WS150 Sequence/Annotation Release
Overlaps_Gene T07D10.2 Source_evidenceePCR790WS150 Sequence/Annotation Release
Chunk_score Abs_score727
Max_abs_score727T07D10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1262136712622458
Overlaps_transcriptT07D10.2 Source_evidenceePCR790WS150 Sequence/Annotation Release
WB_DNA_textsjj_T07D10.21092ctggtcacccttttcggtaacacacttctgatctatgtgatctacaagaacaatgcggtgctgaggcggaaacgggtcactcccgtgcaggtagggatcacagttgttagatagaacaacccaggtctgactttgtacggaagtccggcttagtctggtttacaagccaaactcccaatcaccctcaacctctgattttccagatgctaatgcttcacatgtgcgctgctgacattctattcgccctgatcagcgtgggcccgactatggccatcactgccaccgtccccttcttctacggcccaaacctgctgtgcaagctcaccaaattcctccaagtgatcccaatgtacgcctcatccttcctgctcgtggcgatcagcgcggatcgatatcaagccatctgccgtccgcttgcctctatgaaatcatccatctacaaccgcccggccctctactccggaattgcctggaccgcggcgatcctcttcagcacacctcaactctacctcttcgagaaacgaaacggagattgctcagaaaactacacgaccgccttgcaataccagctctacgtttgcttgttcaactcagtggtatggcttctgccgagtgccatcgctggatggctctacttatgcgtgtgtaaagcggtgtggaagagcacctcgttcagcagctcactgaggaataatatgaagaagatggaacatatgaagctgaccgaaaagaacggcggcatgcaggctcaccacaaaggtaagattctttgccggcacaaatcaaaaatcttatatttttgttgcaggagccacgatgcagtgcgtcgagttggatcgaaggagagttcagaccgtgaagctcacgttgacaattgtcgccgcgaactttgtgctctgggctccgttttgcatcacttcggtgattgatgccgtgtggccaacggcgataagtgagtttttaccttcatggtgcatcgagcaaaattctcagatccggaatattgtgcatctactggttttctagttttagtcatggtatggtacatcgatcaaaatcattcaattttcacactgatttgggtgccttgac