Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T07D10.3   

sjj_T07D10.3RNAiJA:T07D10.3
PCR_productsjj_T07D10.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST07D10.3 Source_evidenceePCR864WS150 Sequence/Annotation Release
Overlaps_Gene T07D10.3 Source_evidenceePCR864WS150 Sequence/Annotation Release
Chunk_score Abs_score717
Max_abs_score717T07D10.3
Specificity_index0.652
Rel_score1
Map_statusUnique_ePCRI1262655312628145
H16D19.3 Chunk_score Abs_score383
Specificity_index0.348
Rel_score0.534
Overlaps_transcriptT07D10.3 Source_evidenceePCR864WS150 Sequence/Annotation Release
WB_DNA_textsjj_T07D10.31593caagttgggtttttggcagtttttctggaaaatttaaaatgtgaacttttacttggccggagtaaaattaggataactggattgaatatggttcaagccctaaaagtgtatagttatggtctttatgtagttgaaaaggtataaatatcattaaaacaagcaagtttatcaacttcctacataatcttccaaaagtagtccactacttccaataagagcttggccatctgtcgtggcgtaaacgaggaatgtttcagtgggcttgttcgctgataatttgtgaatttctcgttgataagacgttgattcacatcaatgatcaccacaattatggatcggtagatattgcactgaaattttgaatatttaggaaaaaaaaacaaaaaaattgcttcagtggggactagaaccctttttatttttttaaccaaaaatggtactttaataaaattttaataatttttagaccattttctacccaaatacccaccacatcttcgggcatattattgaacggagcctctcgctccacatgctccatggcttcacgtaaaactggcaggtttcgtaaaagcacgtcacgttggtaatagcaatacttgaattggtgaccacatttgcaagcaatcacttgtacaaaaaactgaaggaaaaaaattggaaaaaattggaaaaaaaccaacctttctatcaaaaaattcacaattctggcttgccacgtggctctgaaaccccttgttgtcccgaaatcggcgttgacatgtggtacacacatataagccctgaaatttaacaaaaataaaggaaaaactctgaaaaaagagcccaacatatgctcgttcctcctgcttctcctggtagcgcaaaaagtacttgtagttgagaagtaggtgcctggagtctaggaataggtgtttctgaaaacttgatttttaaaaataaaataaattgaattttttggagtattttgagtcaaaaaaaaactagaaaaaagcttacaaattagatgagttatggaagtttgaaacttttcaaacaagaattctgagaaaattttgggtctcacgaaaacttatttcctaacaagtttcttcagaaaattttcaggctaaaaagctttaaatttttcagattcccagcttttccaaattttaaaatacaaattcccaatgaaaactcacataatgctgctcaaaaaagtgtcggatacacttctcattagtttcaaaaatgtacttgcacaccggatccgggcacatatgatcccggccgtgtaaatgtgccacgtactcgttacgtgacgaccaagtacgattgcaacagttgcagatgtaaactggctgaaatttggagcaaaaattttttccttgatttattttttctaaataaaaatttcccaaccttcaaaaaatgtttctgctgatcccaagcttctgtttcaacagatccagttccttgtaaatgctccaaagcagtcttatagtctgaaaaccgtactccacagcaaaatagttggcaggattggtgctccaggaggtaatggaatctcgcatcaatgaggtccaaaaatagtaggctacacgtggaaaatgg