Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T07H8.5   

sjj_T07H8.5RNAiJA:T07H8.5
PCR_productsjj_T07H8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST07H8.5 Source_evidenceePCR702WS150 Sequence/Annotation Release
Overlaps_Gene T07H8.5 Source_evidenceePCR702WS150 Sequence/Annotation Release
Chunk_score Abs_score639
Max_abs_score639T07H8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV69547966955925
Overlaps_transcriptT07H8.5 Source_evidenceePCR702WS150 Sequence/Annotation Release
WB_DNA_textsjj_T07H8.51130tatttacgatgctattagggcgaaaccactttaatgtgaccatttttgttgtgcgaacttataataccgctatcagttctgttgttaacaccttgcatacttcctcagggcgaggcggacgttttcatatttgattactcacccgtttgctgaaaataatcaaaacatagggagttgacaaagagagcaagtcgtttgcaaatgggcttaatagttgggcaattcggctgctcaataatagtttcgatgggtcaatgtccgctgatattttgtttagcatctgaagttttcgttttgagtttaagaaagtgataatatttcaatgactgtaaacctattctaaagtgtaacatgaaaatactccgtaaattgatcttcaaaaaactttgttaagtttggcttttatcatcacttacagcaatagaaaatactccgcagttgatcacaaatgttacaaaggataccagaaaaagacgataatcgctttgttgacgagccgctttgctatattttgatattttgaaccagcaaattatattggcaattatgctgagaagcaccgtaactaccatccaaacaagtatgaatgaatataaaaacggaagatctgcttgagttcttgccacatatgtgtctgataatggattgtattctaagtaagcttgatgaacaagtaatggatatgtaaacaaaatgggtgtaataaaaattaaagctatcagaatatatgtcccatagtgccatatctaaacaaatttaactttccagaaattgaagacccaaatgttctaatgactcacttgaaaatatctctttggcataaaaattaaagtgaaacgattaatagacgtcagaaataaatttgaataactcataaatcccaagtgatattgacagaatataaaaaatttgaatgggaacattgaaccagaatcttttgataaagaatcaaaccagcccgagagataacagtccttgcatgtgcttgcaggcagtcttgatgtgatataaaagttccaatacatccacatattctacaaagtacgtaattctaattcttctagcaggacggagacaatttctataatgcaccttcgaggcgacctacatttgtttcatgcctgcatata