Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T08A11.2   

sjj_T08A11.2 RNAi JA:T08A11.2
Simmer:T08A11.2
PCR_productsjj_T08A11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST08A11.2 Source_evidenceePCR1061WS150 Sequence/Annotation Release
Overlaps_Gene T08A11.2 (3)
Overlaps_transcriptT08A11.2 Source_evidenceePCR1061WS150 Sequence/Annotation Release
WB_DNA_textsjj_T08A11.21157tcgaacttttctcgctggatgccaaagagcttgcaggcaatattgaagaacctgaaatgaattttaatttttgaaattattaagaatttaaaataaaaaccttaataggtcccaacgaaactcgcattccttcacatgcaaacacccatcgttgaataagatgcggtgagttttccaacatattgggccacacataattcaataaatgaataagtgcatcttcacaaccaaatccataaactccaatagcaagatgagcaactgcgtcgactgcaatctgacgatgaacttgatctctttccattaatgcatcaatgagcagcggaacaactgcataaatgtagtcttttgccatttctccaatgtattcgaacatgaatgaaagagcttttaaaactccgttttgtacattaatttcaggtacacgatactcgttcataattgctggaagtactgtaaatggggcacaagtttccgaaacaatggcaatggcgactgttgtacacacacggagctggcgttcttggacctgaaaaataatttattttaaaagaatcacttctaatccgagcctaccttcaaattattgagcaacgttgcgagaacatcatgtggtccgatagcttttgcaataaatccaaatgtattaattgcagctcttcgaatacttttcttgtgagctttaagcaattcgagaagctcgaaacagattctcatccattctcttgcagatacaaattcagatcctctatcagcgattgctcccaccaaatcgatacagttctcctgcactttctcgtgacgattcttcaaaattggtgtcaatcttggcagcaaatctttgattggtggagtcattttggtcattccaataacattgcaaattgctttcaatgcaccgagaattgatccaagtacttctggatattcttctcccaaatactcatacaatactactcccatgtgtcccatcattttctcctcttcacacatatgcataaccggtgcaattctggcaattaaatcagcagcttgttgacgaacttttgcagatttgttgttgagacgccacagaatagtaccacagatttgtgggatatatgccttggcacgtcgtccaagacttgagcagattgttccaaaaccatcaagcatca