Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T08B2.4   

sjj_T08B2.4RNAiJA:T08B2.4
PCR_productsjj_T08B2.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST08B2.4 Source_evidenceePCR360WS150 Sequence/Annotation Release
Overlaps_Gene T08B2.4 Source_evidenceePCR360WS150 Sequence/Annotation Release
Chunk_score Abs_score318
Specificity_index0.444
Rel_score0.799
Map_statusUnique_ePCRI62250566226517
R07H5.11 Chunk_score Abs_score398
Max_abs_score398R07H5.11
Specificity_index0.556
Rel_score1
Overlaps_transcriptT08B2.4 Source_evidenceePCR360WS150 Sequence/Annotation Release
WB_DNA_textsjj_T08B2.41462tcgcgtctagttctaaagtacggtattttgttcagtttcccgttttgcactgataaaacagtttaatcatgttttaatctttcaaattttaatagaaaattacgcgtaatcctgtttaatatatcgtcgggagaaaaaccgagtgcccccttttaagtgaaatttcaaaatgttgcgaaattacgatatatcttttatgaaaactttcatcatgcttttgaacatttatttgattgaactttacgcctcctcgtaattgcattttttttactttgttgattcttactcaaaatttatatttcaacaagaaccgctggaaaagctcaaacgcgcatcagttacaagaatgatttgactctcaacaatactcagcttttacaacaattcttcaagtaggatcccgaacaactactgactctcggagtttggctgaaggccctggcaaggcgatgtggagttgaagatgtatcaaatggatccctaacttcatatgcttggattgtgatgcttattcactatcttcaacaagtcgaactgactctcgtgttgacaaatgatccgtttgaggcggatcattatttggcacaaagagtggatctgtcaggtaagttattagaaaccttgttcattccatcgctcttcatattgcagtatacgaatacattcaatcgtgtatggaacactcgaagaaagtattcacggatcgccgcatgcgttcagagtcatctcccaccacccatctccaaccacaccggatcatggtgctttcgaggaatcgctacgagtcaattggattacgtggtaaattttttaaaaatcaaaaaaaatgctattcgaaaaattgtaaccataaaaaaatttccgaggcttttcttgcaaaatctgtcacaaatctagcataccaatattgaattcgaggttttaaacattgccttcgaatttgtgtttttcttctacttttgaaattgctccatctctaaaaattattaacactttttaaaactattttttccctttttccgtttcaaataaatttttttcgattttcgatttttctattttcactgaaaaaacatcgaaaaatcgaaataatatgaaagcaacgaattttaccagaaattgcacagaaacaactaagtaaacatgagactataatatttgataaaaattttcataatttttttcaacaacttcaaatattgatttatagaaaagtgcaaaacttgttgttactccatgttcagaacacgattagtagaactggtattttgtaaaaccagttcacttgttaagtgtatatctctgtaaaaaaaatttctatgacaaaatgacaaaatgaaatttcgttttttaaccttgtacgttttctatcaaaaattttctgaccgagatataaatattacaataggaacacaatttaaacatgaagttacacacttcaagcagttttatatcggtcagc