Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T08G3.11   

sjj_T08G3.11RNAiJA:T08G3.11
PCR_productsjj_T08G3.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST08G3.11 Source_evidenceePCR327WS150 Sequence/Annotation Release
Overlaps_Gene T08G3.11 Source_evidenceePCR327WS150 Sequence/Annotation Release
Chunk_score Abs_score285
Max_abs_score285T08G3.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1648101116482461
Overlaps_transcriptT08G3.11 Source_evidenceePCR327WS150 Sequence/Annotation Release
WB_DNA_textsjj_T08G3.111451ctccccgtctatttcttgtcttttttaacctacaaccagaataagttgaatccattcaacgcattaaactcacttgtttcttttgtttgtttttcagttctatgtgaaagtttgtaaaaaaaagtttgtaaaagtaataaataattaattggaagggaactagacacctgctgttgacttactccggttgtttggatagaaaatttttttcttggaacttgcattgagaaaataaatttgctgactttgcacttgcaatagattttttattttacttccaatgatttcgcaatccatcgggattgtgatatgtcaaaagcagcttctgcttcttgttttcgttgagatatttgtcagaaataaccttcagcttcaataggctcgctgggtccaagttttcatccagatacccactgtacatcggatcaaaaaacttgctttgcgcacgctcgatatcataccacgcgtgaagatcccaataaacctttctgatctgaaacgataagatatagaaataaattttaattgacctacattttcagaatcttctttattgaatattccttccgaaatagcagtcttgcatagatagtcaatctgatttttcttggccttgaagctatacaaatatttcttcatctcatctcgcacttctttcttgttcgtcggagaaccgtagtttctttcccaaaactccggttctatctggaaattatttacacatgtgtgattgcgatgatagttgtacccaatttttattcagccacttatcaaacgtagcaattgcaggtagagtccagttgtatttttccaagttctcaataatactgtattgcgaagaaatgttcgcaaacaagattaaattgcgagcaaaaatttgaagccgtggtcttgaaacaattccgatagttaaagtattacaaatcattagaaacaatagacatcgcatcgcgatgataacgagtgatgactacgtgtcattgttgcacactttttatacataaatccctcccacgccgcttgataatctgactattcggaggataaagatcgacaacttttgatgttcattgctgtgtagtttgatgcggaagttgttttacacactggcacgattagacaaaaatgatggatggggatcaacagattaaattctaaaaagaatgctacatttttcatagagcgctgtacatagtttgtacagtatgttcatcatttacgacttcatagaaagcacatttatacaaaatggtatttccgcggtcgattagttaacctgcggtaactcaaaaatcaaacgttggaagctttataaatgaatcgaaaatctgtttttatatatttttttatgtgcagtcataagtatttaaattattaaccaaacaataaaattaaaagagttgggtttcccgtggtggattgccctgtctaattgctatattgccctgtcg