Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T09A5.9   

sjj_T09A5.9 RNAi JA:T09A5.9
Simmer:T09A5.9
PF:GL1_8F12
PCR_productsjj_T09A5.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T09A5.9 Source_evidenceePCR783WS150 Sequence/Annotation Release
Chunk_score Abs_score678
Max_abs_score678T09A5.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII78586597859620
Overlaps_transcript T09A5.9.2 Source_evidenceePCR764WS150 Sequence/Annotation Release
T09A5.9.1 Source_evidenceePCR783WS150 Sequence/Annotation Release
T09A5.9.3 Source_evidenceePCR764WS150 Sequence/Annotation Release
WB_DNA_textsjj_T09A5.9962ttagccccacaatttcttcgttagttactttgacatccctggatttgtacgaaaatcagttgaccgaaatttcgcatctcgaatcactcgtaaatttggtttctcttgatctgagctataacaggtgaagaatttaagaaacttttatttcaataataactttcagaatacgccaaatcaacggcttggataaattgacaaagctcgagactctttaccttgtcagcaataaaattgaaaaaatcgaaaatttagaagctttgacgcagctcaaactgctcgaactgggagataatcggtaaatatggaatgtttcaacatcaaaatcacaaattgtgttcagaatcaagaaaatcgagaacattggtcaccttgtaaatttggatgaattatttatcggcaaaaataaaattcgtcagttggagggagtggagaccttgcagaagctcagtgttctcagcttgccgggaaatcgtattgtgaaaattgaaaatgttgagcaactgaataatctgaaggaactttacctcagtgatcagggtctacaagatattcatggcgtcgaacctctggtaaaaagcaattcaaaatacactgagaaatgggtcttttttgcagactaatttacttcttttggatgttgcaaataacgaaatcaaaacgttcagtggcgttgaaagactagaaagtcttaatgatttctgggtaaccgagacattttacgtttcttctatatcttttattattgcaggcaaacgacaacaaagtggaaagcttctccgaaattgagcaactttcaaagttaaagggtcttcaaactgtatacttggagagaaacccgttctatttcaatgatacaaaccaatatcgcagaaaagttatgatgaccctcacccaagtaactcaaattgatgctactacgtgcagaaagccaattgaataactctcggacgcttccaata