Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T09B4.2   

sjj_T09B4.2 RNAi JA:T09B4.2
PF:GL1_6H2
PCR_productsjj_T09B4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST09B4.2 Source_evidenceePCR894WS150 Sequence/Annotation Release
Overlaps_Gene T09B4.2 Source_evidenceePCR894WS150 Sequence/Annotation Release
Chunk_score Abs_score810
Max_abs_score810T09B4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI61840906185202
Overlaps_transcriptT09B4.2 Source_evidenceePCR894WS150 Sequence/Annotation Release
WB_DNA_textsjj_T09B4.21113tggtgcaaaccagaaaatcatatggaactccatccaattacataccaacatcgaataaacgtaggagtctcgatagttcatcaaggctttatcctgatctaactgaacaaataagtaatgcaagaaccgaaaagactagcgagcaacaagatgaaaatgatttcacagatgcggatttgagtttcagtagctcacatggatcagaagaatccgatgtgtcatgtaacgaagtgaatgaaaaatggaaatactggactgttattggaatagttttcattgcgattgttgtgggagcattgattaaaggaagcaaagttacggttggtaaaactacacgcggtatcggaataattaacaattttctagactaacgaatcgtatgaaagttacatcaaatcagtccgatctgtcatcaagaacgagtttcctacaatttcgaaagaaaatcgggatctcttaagactaatcgggcagaaaatctatttggaaccagaaaatcatgctccgttggttgttcttgttgggggaacaccggccaaacaaattgccgaagctgtgaatcgagctgttcaagatgctaaaagtgatgagcatactacggcaggaaaatcatcaattagagtggaaagtgacactgatagagccgagttgcatgcgaatttgcaggaaagtgagtgatttcagaacctcataatattttatgtttaaataactttttaacatctccaaagtaatgtgaaaattcgctgaattttgaaaatataatgcattatttcagtcctcggacccgctcttatttcacaatcatcacctcgaacagctgtgattttggatgtagacctgctaaaatgggatgcagttcttgttcttcatgcgttctcagatcacggaaaatatccagttcccaaaacaatactttttctgactgtttcttcacaacaagattcaacgatggacattgccaacacaagttgtgatgagaaaatggtccagtaagtggtttttgtagatcaaaatagttaagaaattttttgatctacaattttcgcacttacagatttctaacgaaacgctggattgagaacggcggctcttcagacaacattccaccga