Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T09E11.9   

sjj_T09E11.9RNAiJA:T09E11.9
PCR_productsjj_T09E11.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST09E11.9 Source_evidenceePCR1038WS150 Sequence/Annotation Release
Overlaps_Gene T09E11.9 Source_evidenceePCR1038WS150 Sequence/Annotation Release
Chunk_score Abs_score891
Max_abs_score891T09E11.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1234769212349362
Overlaps_transcriptT09E11.9 Source_evidenceePCR1038WS150 Sequence/Annotation Release
WB_DNA_textsjj_T09E11.91671aacggcaactgcctagtttgccaacttgtgtactttgggtcacagttcaatgtatagttgtgttccttgtgatgcttgtggtacagaacctaaacctttttatagatatcgatatatgcataactattaacttacagtaaccatatttttgtagtactcctcctccagtggatggtcgttttgtcccatgaacgttcgattatagagaagctcagcggtacattcgattatggaattgtcaaagggtggaagcatctgaaatcagctatgaaatagggaaatactcgaagaataccttattaaacatcaaagttggaaacgatgcgaccgatctcagatattcaattcccagaatgcaaacattgtggcgtttgtatttagaggcacagtagctttcatcctcaaaattccattgcaccatcctaaacggttcctggttgactttcagataactcaactaaccttgtaataaaatcagtaaccttgccctccttgagacattgatccgtgaagtgtcccggcattccgagaaacgcgctgatttgcagactggagatcagcatctcatccacaccccatctctgaagatgagttactgtttattagggatgtgagacaattcaggaaaatttaggagccagccgatagctgcaaatccctgaaggctttaccaaacttaatgcatcgagatgtgccaaaactgggtttaaaaaagtcttactccctgattccattgatctatgtaagtggacaagttcacttttcgagtcatccaatcaacggcggcccgtgacattgatccctgaacaccgcccttcgagaattttatcttctcattcaatatcgtttcgtccacttttgattctgcaatagactagtactacctgacacacttagctttcttaccatctggaaacattttcagcgaccttggatcccacttgaaattctcttcatcaagcctctgagcttcaggcagcagttccacatcattcgccccgccaagccattcataaacttgttcgagctcgtacacagatttggtgagaagatcatgattctggagcagcatcgcatagttccagccgggcttattgatcagcgcgcggaggcagttgagatgtgccagattgacgttatggccattggagtcgattggttcttggtctgaaatttcggaagtgattgtacaactattagctgaggtgccagattttcaaaaagtgcgaattgtcttccgttccccggccacgtttcaaaattcgaccgagtagtagtcacaaatccgataagacggctagtctaaattcaaattttgcacgcagggcgttcaggctagacacagcgtcggggaacttgccccctctctctctcctccgatccagagaccggctgagacttaccgggtagaagcaaaacgtttggaagacacgctgccattgctctcatctgattcttgaatctcgttggcgccttcttatcaatcgcgaagcaaaatgagttctgaggatgataggacatttgcacttgcttctcaacaagctcatagtccttgtagacaattctggcgaatgctactccattcttcagaggtctcaaaatatgatcatggggtataattctatccataactgcggaacaagacatgtcggggttcgggttttctaccat