Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T09E8.2   

sjj_T09E8.2 RNAi JA:T09E8.2
PF:GL1_2D7
PCR_productsjj_T09E8.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST09E8.2 Source_evidenceePCR749WS150 Sequence/Annotation Release
Overlaps_Gene T09E8.2 Source_evidenceePCR831WS150 Sequence/Annotation Release
Chunk_score Abs_score789
Max_abs_score789T09E8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1318175313182630
Overlaps_transcriptT09E8.2 Source_evidenceePCR831WS150 Sequence/Annotation Release
WB_DNA_textsjj_T09E8.2878cggaacggcgacttatgtatggagttcagtccgaatgtgtcttgtgtgctcatgcgaatgattgcactgcaatgattccattcccgggacccgatgacgagaaactccgaacaaaatggataaactcaatgtgccgcgaaccatggatctatcgttatctgtctactcgtcttgagaaaccaggaagacactatctttgtgcatctcatttcaaccgaaactcacttcgatatcacgctggacttggactctggcgaagagctgcagcatgtcctgttcttgcctgtacaactgatgaagaacgacaagaagtatgggatctaagcaagtctcaaccactttatcatccattgattctcgaaacattcgatgataacggatccggcagacttgactacgatgatgtcctgaactttttgggaactgaaagaatgcgccaggtgtgtttttgaaatcgaagttttgtacataaaatgtattattctagatcgaaaccgagttgaacttccacggacgaaacgattcattgcttcgcagagaaaatcggaaaaagaatactggacgcagcttctatgccgatatgcctaatatttacgagcacggagagcttcaagaagttgaagaccaaatggagggagaagaagaagaagtagtacaagaagaatgtattatctatgaagaagaacatcatttagatgaagctgaagagcttgaggttatcgaggaagaggaagtcgtcgaagaaattgttgaacaagttgtggacgacggggttgtcgtaggtgaagagatgtagactttgatttcattttccctcattttttaattcaaatgttttcattttgaactattctcgaatttccaacactgcattacgc