Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T09F5.11   

sjj_T09F5.11RNAiJA:T09F5.11
PCR_productsjj_T09F5.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST09F5.11 Source_evidenceePCR844WS150 Sequence/Annotation Release
Overlaps_Gene T09F5.11 Source_evidenceePCR844WS150 Sequence/Annotation Release
Chunk_score Abs_score802
Max_abs_score802T09F5.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1518552515186661
Overlaps_transcriptT09F5.11 Source_evidenceePCR844WS150 Sequence/Annotation Release
WB_DNA_textsjj_T09F5.111137aaattggagtggcttcccttgaaaatattttgtgaaaattctgaaatttctcaaaataatctgaaaataaatttgttcaattcagtagaaccgatttcacttgttagtaacagagccaacttacaatttccagaataatcgccagaaaagtgtctcgaaaattccgtgcaataattgaggcaacctgtcgcttcaaggaaatcaaaattgaaattgcaagtttctataacccaactgtctcttttcatctggatgatgcgtgtatcacctacgaaacagtgggccaaagttgcattgtaagctttggaaagaaaaggaagaaggttaagaaacgaaattgtgtggatgttatgctggatgatctctcatcactattaagaaatccgaaactgaatctggaagtgttcaaacttcaattttacattttcgtagaagcaaaccaccgagagactcttgtaaactcccttccagtagttctaaagtctgcagagcctctgaatgtcagtgagtttcaagttaaaagagcacgattcgacgagatggtgcctattttggcatgcttcgaggcgggaaaacttaggaaattgagttttctgcaaagcattgaccaatatgacttgttcgaaactattgttcatttggatcaatggaaagaggcaaaggttctagaagcgttgttctcaacgtatttgatagatgttgaggagctctttcattttgagcattttaagattaaaactgattcatttaccacggaagatgccatacagaccagagatgtgagtttttttttctaggtttcctataaaatttctcagaacaggcccttttttcaaaaaaagtagaggaaacatctaaatttatttatgcatttcaaaataaaattttaaataaaattcatttccagatcctcacagtatctgcccacttccagtacgctaaacttttcttcccggaaaaccgatctacggagcttgcaagagtgttcgacccgaaatatgaaggcccgttgagtggatcaatcaattaccaagcgtgtgatgcaaattttataattgattttagtccacatcactttgagattaagaaaatttttcatacttaaattttttgttcggaatcccccaatggaaaact