Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10B11.4   

sjj_T10B11.4RNAiJA:T10B11.4
PCR_productsjj_T10B11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10B11.4 Source_evidenceePCR891WS150 Sequence/Annotation Release
Overlaps_Gene T10B11.4 Source_evidenceePCR891WS150 Sequence/Annotation Release
Chunk_score Abs_score765
Max_abs_score765T10B11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69377966939429
Overlaps_transcriptT10B11.4 Source_evidenceePCR891WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10B11.41634acgcattcccactttttcactactcttaatggctgcaaagtaaagactgctgtagggaacgtaatcgtcaaatatcttccgttttcgataaagtaattcccaaatggcatccataagcttgacggatggattcatctccaattccacgtgggttctgaaaagaagatcaaatattgtaggaaaatcataataacgatcttactggccgattccgtaatcttcagttggttcaacgacaacgagcattgttttaacttttggatgggcttcaatcgggattgcagtggcgaaatcaggaattgtagacacgacggaaagtgtaaccgatatcacagagcagtccgtttcagtggatgagcttttcgaactaaacatttgaaaatgtcattaaaatgaataaccgacattttcaaaaattttaatgaattctaacccaaatatgatcaggactactgtacctatgattatccacaaaatgagggatttctcagatgcatccgacatctgccaggtttgtctttttgaagacttacatgactaaaacccgctagatgtcggtgcttctaaagacaccctacataagaaaaccaccactacgaatgttaaacatttcagaaacaattctgcaggtacaaactcctcacctcattcccgaataggagctcactgccgacgcacttttcacatcaatacctctctctttcatgtctcgagctcttgatctttgcttacgacagatgcccttttcgaagtttttcttgatttccttgctagttgatcctttcgagaagcattgtcgagagctgcagccgttggttccatccgaatttttgacaagtccaaagcacgcagtgcagagatagtgatcgcatctggaatgtgtaataaaatagatgtttgaatagtttattaggttcacacgtttcaaaatatcaaactaatgaaacagttttcacaaaatataccttccaatagtgtttagcaagtttgacggaaactctttctggcatggaccatcacattttgaagaaactggtgaatatcttcctgtaataattagttattctaggattaaaacaatctttacactcaccgcaaaccattgaagagcaactcttgccggtgctctccgacatctcagttatctcaaaatcatcatctgattcccaagtaaccgagtaatgataggttgctctaaaaagtgataggttgctctaataatatgggccgattagacagaatttcaacagaatattccgaattttgcaaaaagttaatcaagttttgtgtaaagagccgcggaattcataaaaggtcggacaatgaaatttgtaaactcactgtgatgtgggcgcatcgtagatcacatgaagctctattgacttaggtgacgagcagatttctttgatacacttcggaattagaggacttgaactcgaggtttgtgtgatcggctcctccttatgtggtttctcgtcatcgggaactgtcggagactcttgctgaaaatgtgaaatttttatagacctaccgatatttagagtatcaatttcagatagaaaccccaattcctgggttccgtcattgtcagcttgttttatcttccgtgacgaaccccgacggatgttagacta