Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10B11.5   

sjj_T10B11.5RNAiJA:T10B11.5
PCR_productsjj_T10B11.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10B11.5 Source_evidenceePCR710WS150 Sequence/Annotation Release
Overlaps_Gene T10B11.5 Source_evidenceePCR710WS150 Sequence/Annotation Release
Chunk_score Abs_score605
Max_abs_score605T10B11.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69401326941714
Overlaps_transcriptT10B11.5 Source_evidenceePCR710WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10B11.51583cttgattgccggtttcctaaggagtagatcgcctaacaatgagttaaaatatgtctgacaacagtggctgcatgtaacaaaaatttaaaaatgtatcatttatttagcatcatgttttatagctttgaattcccgccatttctaagtttttccactttttgcaaaaactcgtccattttctccaaatataatttcggatactttctgaagtgttcgacgtgtgcagtatcttttagcctagtcgccatgatttgtctcttcttatcacttttctttgcagcacactcgttgaataagttgatttcactgaaagataaatatatttgaatacttttttaaagcatgaactaataatacttactcagcagaacaaacaatgtcattatcggaaaaaatagaagttaagattggtggaagatgtggatgattcaatagataaaagaacggatttgcctcttcaattgtacacaatccagcttttatagacattgtgtcctgcagaaatgatacattggaaatttgaaaagcgttaggtaaaattttgaggtagacaaaaaaaatacaactaaccataatcatttgatatccaaaccttgctgtttcccatttcttgtaaactttataaaagtttccaagtacgaaattcgagtttttgatctgaaaaattgaaatggctctcaatttcatttttgtaagtgagaggctcttctcaacgttaacccattctagagtactgtatagttcgaagccgtttgtggaagtccccatgatcatcccaaagctaaaagctgtgaggcaaaaaatggatcgactatgtatccaactactattagtttttaaaaactagtgcttaccaattgatcataaacatgattcatgaccaatgcatgtttttgcatattctcaattgaaaaagagaagcatgctggacatgaatccataaatattccatcgcatttttcaattgcttttaattctggaaattgtgaatcaagagaagtgagtgcaataaatccattcatagagaatacatgaaatacaagacgatttgaaggatttataaggacagagtcaagtgtgcttgctagatgatccacatttctaccatcctgaaattctttaaaattataactgctttatgtgaaatagaaaacttttgtagaccgatttcagaattttggataaattgagaattgaaagtaccctcgagcaatatgtttcatagaaaacagtcttaaattattttccaatttttactaattctactgcattctatttattaggctccacttattctgcattggcagttcttttttagttttattggaatatatattctattactgcgtattccaaatgttaactggtagagtgttatatccaaagttagtctactaccgtatagcaaaactatttcaggccaaacttaaacgaataattgtgaattgcacgaaatgggctgacattttgtcgacccttatttggaattttcgtcaaaatgtgcattatattttttcattatatttttcttctgctcaccttagttccccatcctttaacagccgcaagagctgtgaattgaa