Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10B11.9   

sjj_T10B11.9 RNAi JA:T10B11.9
Simmer:T10B11.9:Screen_A
Simmer:T10B11.9:Screen_B
PCR_productsjj_T10B11.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10B11.9 Source_evidenceePCR698WS150 Sequence/Annotation Release
Overlaps_Gene T10B11.9 Source_evidenceePCR698WS150 Sequence/Annotation Release
Chunk_score Abs_score614
Max_abs_score614T10B11.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69547936956851
Overlaps_transcriptT10B11.9 Source_evidenceePCR698WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10B11.92059tgaaaatgtacacgtgaacgaacttctgctagactttcatcagatctgaaaatgtaatttcgataaagctttgaatccggaaattgtaattgtttttcaaaatgatttttcgaaatatccaaaattaaatgttttaaaactaacccagtattcacaggtccaacggataattcagagtgtccccaaacagctgtcgaaggtgcgaaaaggtgtgtctgggatactgtagttgtcattttcggcggacgttgacccccaattactccgtgttggttaggaaggacttgatgattttgttgttgagacatgttatacatatctggataaactgaaataataattgtttaggttttgtaaagttggtctcgacacgaataatattttttcaaacggtggtggcgatgtgtttgtacagcaattcatcccctgttattttacaaatgttatccagatattcatgtgttttttagcagcgggaatagggttgctgtactgattaaagacctagattttattgcgcaacgttcatttgaaaatatttcaagaccggctaccgtatctttgggaaggaaaattgctattaagaaaccatgagatcatgagaatgcctgacgttttggcgcgggaatatctcgtagcgaaggcacctaaatctctctttgccgctattttcgcgccagaaagtaggcattctcatgaactgatggtttcgtaatataaactaggtagtgcacgattttgttcaaacatgattctatatttttttgaagataggtttttgaaaaaactgcaagttgaaagtaagtgtaagtgtattaattaattacataaattttataattttggtaagaaaataaatgcactttaattttttgaaatcataaaactaaccattcatttgccgatttacgggtgttaatggagatgatccatgtctttgaacaactgtatgttgttgccatggagcactatttgcttgttgtaattgcatatgctgacgtggcatttgcatggggctctcaggagttggaggaagttgggacatgttttctgtgagttgtttaacaacattcaatgattgagtacgtgataaagctgcatgcttgttcttgaacatttcgtattgcatcgattttactgaaattttgaatttaatttaggaatatacaagatcagttttaggtgtgtgtttatcaatttaataaggaaaacaagtcaatcaattgaacagagaccacaacaatttgtggggcgaaactcaagtctgtacctccgaattcaatcaaaaattattcaagttctattttacgctgaatttgcctaaacgacatttttttagccacgaaaatgagtttttgagggtttcaacatttgacaagcactttgagtcccttttaggaaatataattttttttaaagcaaacctaaactttcatgaaattttctgtcaaaaaatgttttcatatcatcaattcaaaacgattttctagtggtttttgagctgttaaagtactctgtttttggcacaaaatgttacaaacagccaaaaagaatggagaaaaattagggttgaaaatttgaaatctgacaaatttgaaaaacaaattttaaaattttaaaattttaaaattaaaaatataaaattatacgggtggggtttaattcaaccaaaacatacctgcacccaatgattttttctgttgattctctttcatcaatcgctcagttacactcatatgttgcccatttgctctttctggatgataaaatttgcatttattcccatatgtacattttcttgcatatggacacacaagaggatttgatgaaactacaggaacttttgataagaagctttcgattcgcggaccatgacgacctgatggatcatccggtggcataaatctgaatttactgagtattaggaaagacgatatttaaaaaaattgaatttttttagaacaatcctagcttctaaagtttattattctataaactaacttaaaaaaaaaacacaaaagtcttgatgttttttgtctccaaaagtgagaaaaagtgc