Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10C6.12   

sjj_T10C6.12RNAiSimmer:T10C6.12
PCR_productsjj_T10C6.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10C6.12 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (9)
Overlaps_transcriptT10C6.12 Source_evidenceePCR398WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10C6.121019acatctaccaaccaatcatcaccatgtctggacgcggaaagggaggcaaagccaagaccggaggaaaggccaagtcccgctcatcaagagccggactccaattcccagttggtcgtcttcaccgtattctccgtaaaggaaactacgctcaacgtgttggagccggagccccagtttacctggctgccgttcttgagtacctcgctgctgaggttctcgagttggctggaaacgctgcccgtgataacaagaagaccagaattgccccaagacatctccaactggccgtccgtaacgatgaggagttgaacaaactgttggctggagtaaccatcgcccaaggaggagttcttccaaatatccaagctgttcttttgccgaagaaaaccggaggagacaaggaatagatgccttcttaaaacattttaccgaacccaacggccctctttagggccacaaatatttaaaatcctctattgaacatgaataaaaattatttttatcaatggtttttgcacgtactttattataaattgaaaatcgtttgcaaagaagaaacttctttttggatttggttgattcacaaaacgattcgtaattattttcttctgtcttacaaatgttaattaaaattggacgaggtcattccaaattcaaataaattggcgccaaattcaaagttgtcattgaatgtgaccttgttgaacaatatgattttagagaggttttcctggttgagtatttgaatacacgtggttgcaaattccttagaaacaaagatatagtgacgtcacaatacctacaattgtttggacctggatctgactcagataggcaattgatgacgtcattaatgacactttctgtgaggacagtaaaacattttgatattataaaaatatactaaattgtatggctctaaagtttcctggttttgttctttttttttaataagttaaaaaataatgaataatttattcaaattggattgaaaatgattggatcatatgtatgtggcc