Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10C6.14   

sjj_T10C6.14RNAiJA:T10C6.14
PCR_productsjj_T10C6.14
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10C6.14 Source_evidenceePCR312WS150 Sequence/Annotation Release
Overlaps_Gene (6)
Overlaps_transcriptT10C6.14 Source_evidenceePCR312WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10C6.141393tgagtcttcaagtcaactgcaacaatgtccggacgtggaaagggaggaaaaggccttggaaaaggaggtgccaagcgccatcgaaaggtccttcgcgacaacatccaaggaatcaccaagccagctattcgccgtcttgctcgtcgtggtggagtcaagcgtatctctggactcatctatgaggaaactcgtggagttctcaaggtattcctcgagaacgtcatccgtgatgccgtcacctactgtgagcacgccaagagaaagaccgtcaccgccatggacgttgtctatgctttgaagcgccaaggaagaactctgtacggatttggaggataattttatctctcgatttcatacaaccaaccaaccgaacccaacggccctctttagggccacaaatctaaaatcctaattttctgtgcataaatatgtgttccttacttatccttgagtttatatttttgccttttttgcgttgttaaagcaatgttgaaaagtgtctgcttccataccagaacagatcataaaggaggtattagtgacgtcaccaaatgcctatctgaatcaattccagttccggcaaacaattgtttgtgctgtaatgccactatatctttattctaagagaattgcaaccacttttttgaaaaatacagcatatcagagaaaactctaaaatcatattgttcagccaggtcacagtcaaggtcaattttgaatttggcccaatttcagttacaggctcggataacggagttgattcaacttgttaaatattaatctgaatacaaaaagattgagtatgaaaatttacttttcatttttaatgtgatttttttgaaaaataaataaatataatttgtagagcaccaaaacgtccatatatctcgtttacaaaagcatcgtgttgagacttgagaaggcttctggtgcctgtagaggtgattctgaaaaatgctttaaaaaaatccacaaaatcaaaaagatctaaaatatcttaaataaagaaatttagataaatcttaaaaaaatctaaaagatgtagtttttatacaagttttctatctataattttcctatcattacctcaatcagcgatttactcttcaaaaaagtctgagcatttctaactttgtctcattccatttctattttgcacacagactgtaaatcggctcactaagatcagagcaaacttaaaaaaatatataataatgcattcagggagaatagaagagaccacacaaccaagtagtcaggaaaagtgccgaatttgggcttaaattatttgttttatactttttattgcctccacccgtagtgttttcttatctaagagactctcgtatattgaacgtcttgagtttgactgattctgtcaactctcccattt