Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10C6.4   

sjj_T10C6.4 RNAi (5)
PCR_productsjj_T10C6.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10C6.4 Source_evidenceePCR721WS150 Sequence/Annotation Release
Overlaps_Gene T10C6.4 Source_evidenceePCR721WS150 Sequence/Annotation Release
Chunk_score Abs_score595
Max_abs_score595T10C6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1602409516025188
Overlaps_transcriptT10C6.4 Source_evidenceePCR721WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10C6.41094aaacattttcccagtttgcggcaacttccatcacatttttcttctttttcgtaggaatttttttgttagtttatactttttttgcgcactaaataatctccaaccgtattgaaacattctagaaacacaatattaattgtcagtaattctgcaattttcggaaatatatccctgacaattttgccaattatgctgggcacccactttctgatggctttcaacaggttttgtgcttcaagtatgccatttggatacagaaaaatctttaggtatgtttataggatgcctacctgcctgcttggtaggctcacggtaggcgtaggtcgcctgaggagattacgtttttcagcaaaaattacgtactcacttacatcatcataaattggacacttccccccgtaatttattcgtattttttcttcttttataattgttccttcccgtttttccaatttgggtgggttttcatggaagctcagcggaatgaggtgagatttcggggtcttgccacgagcgaaacttttcggctacagtacttggtgcaaatggtctcgacacggcaaaaaattggttacggtagctgaagcgtgacaggaccccgagcgtgattttgattgagcatttccagacatgtggagcaaaacttctactgttaagcctatctgttcagttcgtgattatctttattatcacaattctggatatttccacgtttatcattcttatcacttgtcgaaaatcgatatttaaagggcaaagtaaagagaataaacaacgcgatatcaattttgcgatgcaggtgcgctgtaaacgagctcttgcaaaataaattcaaattccttgttttaggtgataattcagggaattgttatggtgttttttggtgtttggtatgtttccggttattcgtttttgcctggcaacaggctggattggaaaatttttatgacaactacggtctcgtcttctttaactaattgcctagcaccgttagtgctatatttcacgagcaatatcaatttttcagttttcagaatagtaatatgttttttcaatgcagaatatcgccgatggattattcgtttgattcgccg