Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T10E9.7   

sjj_T10E9.7 RNAi JA:T10E9.7
Simmer:T10E9.7:Screen_A
Simmer:T10E9.7:Screen_B
PCR_productsjj_T10E9.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T10E9.7a Source_evidenceePCR781WS150 Sequence/Annotation Release
T10E9.7b Source_evidenceePCR781WS150 Sequence/Annotation Release
Overlaps_Gene T10E9.7 Source_evidenceePCR781WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI65302646531958
Overlaps_transcript T10E9.7b Source_evidenceePCR781WS150 Sequence/Annotation Release
T10E9.7a Source_evidenceePCR781WS150 Sequence/Annotation Release
WB_DNA_textsjj_T10E9.71695gtgttggctcagcaacttcaaggatcgtttcgtatccactggtgatcgactgattacggaaggctgggaatgtctcccatggagtgttcaaatcgaatttacggaattcttgagccaattcagatggttcatagacgacacgcttcagctctggatcgtagcggacctcgttgtatcccgaaagtggataatccttgcggaatgggtgaccctcgaaaccgtaatcagtgagaattcttcgaagatctgggtgattgttgaaccatactccatacatatcgtacacttcacgctcaaacctgaaaaaaattagaataaatatatggtgacttggccgatttgagaggtgaaatcttttgagaaagttgccataatttaggaaacgactataatttgtcagaaaataattaagtcataaatgttcatcagtttctgttagtaatcttgattttttggatatttttcagtttattacaataaaaagaaaaaagtggttttcaaacgagttctgtctcattcgacacatcatgtttatgcaagattattacgaaaatttttttggctgttttttgcagacttttaatgatttcacatgttttttgtcggggtgggtaactttaagtttgtttcaaaattttttaaaaatctgcagaaattcgaaagtctacttttaaatgattataattcttaaaagtctacaaaaccgtctttggagaaacaacggatccgggagcaatcaaaaaatgcattggaataatttcagatcgaacttttcaggttgaaatagtttgttcaattttttttatatcttttcatagtaattgtgatttggtattatccatctttgatattaatttcacttctgttacaatagttaaaataaactaattctttcaaaaacttaaattacatttaattaattaaaagttcttaccagtcagcacccttgaaaactggagtggcagaatcgattggagcaatttcatcagtgtatgtacgaacacgaactctggcgttgaatcgaacagagtaaagcgaataaataacttcaagacgattcttgcgagttggaacatccattccggtgatgaaggttaagttggtgaattgagcagaatgatttccctggaaatttagattttttgttgataaatcaagcattaaaccaagaaaaaacggtttttgtgcattttttctcaattttaataaaacgaagtataatttaaaaaaactgtaaaaccgacaatagtttccagataaaaaatggttatgtactactattgcagctgaaagtcaaagtgttacttttatttcaaatttttgtgtgtgattataattaaagatttaatacttactttaaggaaggaaagaactggaacaactcctgatggatgaatcaagagctctaactcgtctccggctgcaaattgcactttttgcacaaactttggcaggcactcggctgcatactttccaaaattagccaaccgttcacgtttgtgttcgtcgattttccagatagttgctgaacattttttgttaaattttgtgtaaaatgcaattgaaaattttacgtttttttggagattctttcttatcgccagtctggttggtctgggcaacagcagcggtggtggaaattggcgaatttcggacaatttgccgggaaactgcctgacggatcacactacccaa