Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_T11F9.9_b   

sjj_T11F9.9_bSequenceCCATGCTCTTTTGGTTGGTT
In_sequenceT11F9
PCR_product sjj_T11F9.9
smd_T11F9.9