Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T12B5.6   

sjj_T12B5.6RNAiJA:T12B5.6
PCR_productsjj_T12B5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST12B5.6 Source_evidenceePCR1048WS150 Sequence/Annotation Release
Overlaps_Gene (7)
Overlaps_transcriptT12B5.6 Source_evidenceePCR1048WS150 Sequence/Annotation Release
WB_DNA_textsjj_T12B5.61139ttttctccgtcaatcaactttgtctgttcattgtggatcacattcgaactcgaactgtcattttctgctgtattatatatgatttcagttccactccatatttcgacttcatctttcctcaagtacaaatagatgtagtcaaaacgtaatccaattttatcgacagcagttctcaaactgcgacagacttttctcgctctcagtctgtaatatcaggttgtcccataagtttttgtactattttttttttgaaaaaaatttatttctctcaagcgacaagtagtactattcacacaagtattcaccattagtgtccaccacttgttgccatttactaggtaacatcatgatgccacgggagaagaaatccggcgaacgcgatgagaagaaagtggagagttcagttttgagatgctcttcgtcgtcgaattgcttgtcgcgcatgtagtcactgagagacaagaacaaatggtagtcggttggtgcgagatctggagaatatggtggatgcggtaaaacagtccaaccaagatcttgcagcttttggaaagtcttcttggcgacatgaggcctagcattatcgtgaagaaaatatagtttttcatattttccgttggtcttttctgcaactcggtccaattgggcacaatagtaatcagcagtgatagttttattagttggcaacaattcccagtgcacgggtccttgaacaccccaccagacacagatcataatcttttttgggtgaagatcaggctttggcgtcggtattcctttctcaccgatcggaagccattgacgttttctggaatggttaacatagagcacccacttctcatctccagtaaccagattgttcagccaatcgaactttcgacgaaaagttagaagttgagtacaaacgttgacccgagtgagcttctgtgatgccgaaagttcatgaggcacccaaattccaagttttgaagtaaaaccaaggcgacccaagtgacgtgcaattgtgctatgacaacactcaagcttctcttccatttcacgaagactaagacgaggctcttcctccaccagcttcactaggtcttcttcatttaactctaccggtcgcccagaacgttctatttcttcgagactgaagtcgc