Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T12F5.4   

sjj_T12F5.4 RNAi JA:T12F5.4
Simmer:T12F5.4:Repeat_a
Simmer:T12F5.4:Screen_B
PCR_productsjj_T12F5.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST12F5.4 Source_evidenceePCR1124WS150 Sequence/Annotation Release
Overlaps_Gene T12F5.4 Source_evidenceePCR1124WS150 Sequence/Annotation Release
Chunk_score Abs_score1082
Max_abs_score1082T12F5.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI37157093716881
Overlaps_transcriptT12F5.4 Source_evidenceePCR1124WS150 Sequence/Annotation Release
WB_DNA_textsjj_T12F5.41173gggcaagaagttgagagtgctcgtgctcgtggagcattgtcttttgcctttttcgattgaagagatgacgagagaattgaagatgacatgtagtgggattcgattgctctgaaaacaaatcatatttttatttgcaaacatgaaaaagtgaacttacacaaacgctcgttccaagtcatcatcatcaatcgcttccaaccattttcggaataaagagacaaattccacaggattcggattatttcctttggtcttcaagaattttataattaatgtgtaatgcggaagcatggttcgagacatggatccatcgatttttcgaacacggaatgcaaatgcagccagtacttgcttcatttttaaccgaatcgatgagttctcatccattggagtttgcagaatagcaggaagtcccgaatgcgaagatctttcaatagttttccttcgatttctgatcacaaaccgtcgggtcacaatcttctcattcggatcagcacatctccatctgactcctcgaataactcgtttgcattcagttgctccgcagttgcaggccatgtcgaacggcaacaaatcactcttgtcaacagttatttcagcatttggattcaaatcagacaatgcaaaaacacctgcccgatagaatccattcaccgaccaaacttcgagacgagagtttggtttacaagaatgcttgatgaatcgagcaatgttcgatcgtttggttgcatcgacgaacaaatgagcagctatcgcaataattctcgggtcccgatcttgagcaaacttctcctgagcttgttcccttgtgatcacttcaccagcgtattcacacaaaaactctccagctcgtctagcgatttttgtcttgagcactctcttggaccgtggcccatttgaaacacagagcttgtttccacaatcttccttccagaatcgtcgattcgagcaatacggcacagaacaatcactgctacactgaactctcaatgctcgattcagacagtccatgtcagatgtgcatgcaccttttgtgcacccacatgttagactaggagccatccagagaggaataatatcatctgatgagggaacacttttagttatttcaaagtattctccgttgaacttcttctccactggttcgggattcacaatttccgatggttctcg