Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T13A10.11   

sjj_T13A10.11 RNAi JA:T13A10.11
Simmer:T13A10.11:Repeat_a
Simmer:T13A10.11:Screen
PCR_productsjj_T13A10.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST13A10.11b Source_evidenceePCR989WS150 Sequence/Annotation Release
Overlaps_Gene T13A10.11 Source_evidenceePCR989WS150 Sequence/Annotation Release
Chunk_score Abs_score863
Max_abs_score863T13A10.11
Specificity_index0.9
Rel_score1
Map_statusUnique_ePCRIV62774876278612
Y105C5B.12 Chunk_score Abs_score96
Specificity_index0.1
Rel_score0.111
Overlaps_transcript (3)
WB_DNA_textsjj_T13A10.111126tcaacgagagctggtcctttggatttggcgcggagatctttatcaatcttgagcttacgagcctgctcccatggaaaatcgttgtgaccgaagtgaccattttcagcggttggctcatagatggctctcttcaagtccagatttctgaaattaactgattggttaagaagcatttagaagtacacttacttgatgatcattcctggtctcaagtcaaagttgtcgttgacaatcttcaagagttcagcctcgttgagtgcagaagttccaaacgagaagaccatcaccgaaagcggcttagcaactccgatagcataggaaacttgaacgagacaacgacggcagagaccagccttgacaagtgacttggcaacccagcgagcagcataagcggcagaacgatcgactttggttgggtcctttccagagaaagcacctcctccgtgagctccccatcctccgtaggtgtctacgatgatcttacgtccagtaagtccagcatcacccattggtccaccaacgacaaatgatccgcatggattgagatggtagacggtgtcgttgtcgataagatttccaggaatgaccactttgataacctgaaaatttaaatattcgtttaaaaagtaccaaattcaacagtaaccttctcaatgagttcctttctcaaatcctctagactgatatctggcgaatgttgggtagagatgacgacagtgtgaacacgaagtgggacacaagctcctccctcggatgaatactcaatagtgacttgagtcttcgagtctggacgaacccattcgagctctccagaacgacgaagctcatgaagcttgtagttgagcttgtgcgacaagagaagagtcaaaggcatggcttcttcggtctcatcggtggcatatccaaacatgattccttgatctcctgcaccaacatcagcaatatccttatccacatgaactccagcggcgatttccggagactgttgctcaagagcaacaagaacattgcatgtcttgtagtcaaatcctgaaacaacatcattcgaatcaggatacatttccgtctgcttacctttcgaggaatcatcatatccaattttcttaatgacgtttcggacgagaac