Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T13F2.7   

sjj_T13F2.7 RNAi JA:T13F2.7
Simmer:T13F2.7
PF:GL1_6A10
PCR_productsjj_T13F2.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST13F2.7 Source_evidenceePCR995WS150 Sequence/Annotation Release
Overlaps_Gene T13F2.7 Source_evidenceePCR997WS150 Sequence/Annotation Release
Chunk_score Abs_score892
Max_abs_score892T13F2.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV97764059777602
Overlaps_transcriptT13F2.7 Source_evidenceePCR997WS150 Sequence/Annotation Release
WB_DNA_textsjj_T13F2.71198ccttccaaatgttctcgcatccaatgcatttccgttcgattcaaatgtttttggagaacacttcccatcgctggcttcaaaattgaatcaggaactccattatattcagatgatactgtgtcacagagctcataaagctcatttttttcgtttatttcagcgaaattcagttttcgttcatcgatgatctcgagaagacgattcgaaattacatcttcgtcaatttccggtgcgagagtttgtcccacattttcagaaatatatgattgtttgagaggttttttagcggaagttgattgttgaatatcatccatttttgaatataaagaatattctcgcgggctcaatagtctgaaaataatattggaatgattttaagatttaatcaatgaaaataaacatacgttactgtacattcattatcttcatcactcatcgaaaacttcgatggtccagccaaaactttctctgcggtttctttatcggacagtaaaacttctacttggaataatccatttgaagatggcatgggaagagtttgaaaatgaattggagtttttccttcgaaaaaatatgaaatcatatgatcatcaattgattttggagcatcgagaagaaaaactagtcgagtatcattagaaatatcaaagaattgacgagaagactggaatgtttcgacggaaactgaaatctcgcaatattaatttgaagaatttagtttttaaaaaacttacaaaactgtggatcaacaagagcttctggtcgtattccgtcgattatcatcttttgaattgttgaataagcttcacgtgcaccagctactgtcgaaaacacaaattccacttttccatattttatttgctgaaatattctagaaggttgatacatttaataacgctgtcaaattaccttttcatctgtatcttctggtcgtgaaaatgaaacatcaaaaatgacacatcgattgagtaacatttgaaactaaaaatatccatttgtcaacatataaatgacaaaaagtttgatgatacctgtcgatttctaagccaacctccaggatgtttcaaattctgtacaacaattgttcgaagcgatttatcattgattttgtcctctgcaacattttcaacagaatcaaacgcgtctgactgagtatccacgttttcgtattccttcaccgggttcagttcgatcattt