Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_T13H5.4   

sjj_T13H5.4 RNAi JA:T13H5.4
Simmer:T13H5.4
PF:GL1_8G5
PCR_productsjj_T13H5.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T13H5.4 Source_evidenceePCR1034WS150 Sequence/Annotation Release
Chunk_score Abs_score950
Max_abs_score950T13H5.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII85237048524892
Overlaps_transcript T13H5.4.2 Source_evidenceePCR1034WS150 Sequence/Annotation Release
T13H5.4.1 Source_evidenceePCR1034WS150 Sequence/Annotation Release
WB_DNA_textsjj_T13H5.41189aatgttggcgaaatgagaggtattcggaattccaagacatctcattccatgagaatgtcgccactcctgcaaatatcaagtttttgaacgagaccaatataatgaacttacgttgaaatgcttttggaacgcctttggacctttgtaagtttgatttccacagatttcacatgaatatgatagattgaggccgtgaagtttgtacaaccaatacggaattggctttccatcccaaccaagcggtagattttttggattatatggtgcactctcatcaatttcttcctcttcctcgatctaaaaaatgaatttttaaatgtttctaaaaataactagagaaaataattcaaacctaccacaatttcctcctcctcctcttcttcgacctctccagcagatctagcttgttttctctcgacattttcgcgagttccagtacgttcttcagctagaatatcagcaagtgccataatatgagcttccgtttgtgccaatgtcaaatttttagcgttctgcttttcggcatcggaattatttgaagacattgctgctttttcgagatctgacagtttatgccctttggtagcgaaaagacgatcagcgcgttctttcagagttctgaaaaataacgaggactacaattaaaaaatccaaatatttttaactcaccctccacatttcagaccaattgccatgagagctcctttcaaacgttccaatcccaatccctcgagttcttcagcactattgtatggagataaatccacagcagctgcttgaggtccgttcttgtttttatcagcttcccaaccaggaagattccctgctttaaatgctctttctacagtttgattaacctcagagaaaactgaatcgagatcatggagtgggcgagttcgttgcatgaaagaaacaagatagtcttttaaggaattgatgtattctttatatgctcctgtcttcttggtagtatttttcggtatctctgtgaatttctcaaaattcaacaaatacgtcatgtaatcaacccttttgatgttcttcaagttaatgaatttgtcgtattgtgcatgaagatctagaaaacgaccgtaagcttcttcatcactgaattcaaccatatctggctcggctctttcagggttgatgatttcttcattgattttttggaactccacggtgagtggtt